Fraser extracellular matrix complex subunit 1 (FRAS1) - coding DNA reference sequence

(used for mutation description)

(last modified April 19, 2018)


This file was created to facilitate the description of sequence variants in the FRAS1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from VERSION NG_015812.1, covering FRAS1 transcript NM_025074.6.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.5020
                                         aactttaaaaagctgcttcg       c.-421

 .         .         .         .         .         .                g.5080
 gacaaaccagagccaggatttccactgtcggggacccgggatcggaagggtctagcccga       c.-361

 .         .         .         .         .         .                g.5140
 gggaaatgctggaagatcccatcggccagtgaccagcaactttccggcgagattttgacg       c.-301

 .         .         .         .         .         .                g.5200
 cggagaactgtgctctgcctcctcttattctcccaaagctcacgttggcgtcctgccttg       c.-241

 .         .         .         .         .         .                g.5260
 cgggggaactcggcgcgctctctgcctgagcagcgagtgaattgaaccccagcccgctcc       c.-181

 .         .         .         .         .         .                g.5320
 ggcgcctccgggctgatgagtgtcgctctccgcccgtccatctctttttcccggaggtaa       c.-121

 .         .         .         .         .         .                g.5380
 aggcccgcggtcccccaccttcagtgcgcccgggttccaagcgccggagccagcgttttg       c.-61

 .         .         .         .         .         .                g.5440
 gcggagccgcttcttggatgctgaaggctgggctcctccatcgtgggtgccgaggcggcg       c.-1

          .         .         .         .         .         .       g.5500
 ATGGGTGTCCTCAAAGTGTGGCTCGGGCTGGCCCTAGCGTTGGCGGAATTTGCAGTATTG       c.60
 M  G  V  L  K  V  W  L  G  L  A  L  A  L  A  E  F  A  V  L         p.20

          .       | 02 .         .         .         | 03         . g.184952
 CCTCATCATTCCGAAG | GTGCTTGTGTCTATCAGGATTCCTTGTTGGCG | GATGCCACAATT c.120
 P  H  H  S  E  G |   A  C  V  Y  Q  D  S  L  L  A   | D  A  T  I   p.40

          .         .         .         .         .         .       g.185012
 TGGAAGCCCGATTCATGCCAGAGCTGCCGTTGCCATGGTGATATTGTTATCTGCAAACCT       c.180
 W  K  P  D  S  C  Q  S  C  R  C  H  G  D  I  V  I  C  K  P         p.60

          .         .         .       | 04 .         .         .    g.192687
 GCTGTTTGCAGAAACCCTCAATGTGCCTTTGAGAAG | GGAGAAGTGCTTCAAATAGCTGCC    c.240
 A  V  C  R  N  P  Q  C  A  F  E  K   | G  E  V  L  Q  I  A  A      p.80

          .         .         .         .         .         .       g.192747
 AACCAATGCTGTCCTGAGTGTGTTTTGAGGACTCCAGGATCTTGCCATCATGAAAAGAAA       c.300
 N  Q  C  C  P  E  C  V  L  R  T  P  G  S  C  H  H  E  K  K         p.100

           | 05        .         .         .         .         .    g.199873
 ATCCATGAG | CATGGGACAGAATGGGCCTCTTCTCCATGTAGTGTGTGCTCTTGCAATCAT    c.360
 I  H  E   | H  G  T  E  W  A  S  S  P  C  S  V  C  S  C  N  H      p.120

          .         .         .         .         .         .       g.199933
 GGGGAAGTCCGATGTACCCCCCAACCATGCCCACCGCTGTCATGTGGACACCAGGAGCTG       c.420
 G  E  V  R  C  T  P  Q  P  C  P  P  L  S  C  G  H  Q  E  L         p.140

          .         .         .         .          | 06        .    g.202683
 GCATTCATCCCTGAAGGAAGCTGCTGCCCAGTTTGTGTGGGCCTTGGGA | AACCCTGTTCC    c.480
 A  F  I  P  E  G  S  C  C  P  V  C  V  G  L  G  K |   P  C  S      p.160

          .         .         .         .         .         .       g.202743
 TATGAAGGCCATGTGTTTCAGGATGGGGAGGACTGGCGGCTGAGCCGGTGTGCCAAATGT       c.540
 Y  E  G  H  V  F  Q  D  G  E  D  W  R  L  S  R  C  A  K  C         p.180

          .         .         .         .         .         .       g.202803
 CTGTGTAGAAATGGGGTTGCCCAGTGCTTCACAGCTCAGTGTCAGCCTCTATTTTGTAAC       c.600
 L  C  R  N  G  V  A  Q  C  F  T  A  Q  C  Q  P  L  F  C  N         p.200

     | 07    .         .         .         .         .         .    g.212512
 CAG | GATGAGACTGTAGTCCGAGTCCCTGGAAAATGTTGCCCGCAGTGCTCTGCAAGATCC    c.660
 Q   | D  E  T  V  V  R  V  P  G  K  C  C  P  Q  C  S  A  R  S      p.220

          .         .        | 08.         .         .         .    g.214297
 TGCTCTGCAGCTGGCCAAGTATACGAG | CATGGTGAGCAGTGGAGCGAAAATGCCTGCACC    c.720
 C  S  A  A  G  Q  V  Y  E   | H  G  E  Q  W  S  E  N  A  C  T      p.240

          .         .         .         .         .         .       g.214357
 ACGTGTATATGTGACCGGGGTGAGGTCAGGTGTCACAAGCAGGCCTGCCTGCCCCTGAGA       c.780
 T  C  I  C  D  R  G  E  V  R  C  H  K  Q  A  C  L  P  L  R         p.260

           | 09        .         .         .         .         .    g.214722
 TGCGGAAAG | GGTCAGAGCAGGGCTCGGCGTCATGGGCAATGCTGTGAGGAATGTGTGTCT    c.840
 C  G  K   | G  Q  S  R  A  R  R  H  G  Q  C  C  E  E  C  V  S      p.280

          .         .         .         .         .         .       g.214782
 CCTGCCGGGAGCTGCTCCTATGATGGAGTTGTGCGGTACCAGGACGAAATGTGGAAGGGC       c.900
 P  A  G  S  C  S  Y  D  G  V  V  R  Y  Q  D  E  M  W  K  G         p.300

          .         .         .         .         .         .       g.214842
 TCGGCCTGTGAGTTCTGCATGTGTGATCATGGCCAAGTGACCTGCCAGACTGGAGAGTGT       c.960
 S  A  C  E  F  C  M  C  D  H  G  Q  V  T  C  Q  T  G  E  C         p.320

          .         .  | 10      .         .         .         .    g.226124
 GCCAAAGTGGAGTGTGCCCGG | GATGAAGAATTAATTCACTTAGATGGAAAGTGTTGTCCT    c.1020
 A  K  V  E  C  A  R   | D  E  E  L  I  H  L  D  G  K  C  C  P      p.340

          .         .         .         .         .  | 11      .    g.228837
 GAATGCATTTCAAGGAATGGTTATTGTGTTTATGAAGAAACTGGAGAATTT | ATGTCATCA    c.1080
 E  C  I  S  R  N  G  Y  C  V  Y  E  E  T  G  E  F   | M  S  S      p.360

          .         .        | 12.         .         .         .    g.230283
 AATGCTAGTGAAGTTAAACGTATTCCA | GAGGGAGAGAAGTGGGAAGATGGCCCTTGCAAG    c.1140
 N  A  S  E  V  K  R  I  P   | E  G  E  K  W  E  D  G  P  C  K      p.380

          .         .         .         .         .         .       g.230343
 GTGTGTGAGTGCCGAGGGGCTCAGGTAACTTGCTACGAGCCCTCTTGCCCACCATGTCCA       c.1200
 V  C  E  C  R  G  A  Q  V  T  C  Y  E  P  S  C  P  P  C  P         p.400

          .         .         .         .         .      | 13  .    g.231840
 GTGGGCACACTGGCCTTAGAGGTGAAGGGACAGTGCTGTCCAGACTGCACATCAG | TTCAT    c.1260
 V  G  T  L  A  L  E  V  K  G  Q  C  C  P  D  C  T  S  V |   H      p.420

          .         .         .         .         .         .       g.231900
 TGCCATCCAGATTGTTTGACATGCTCTCAGTCTCCAGACCACTGTGACCTCTGCCAAGAT       c.1320
 C  H  P  D  C  L  T  C  S  Q  S  P  D  H  C  D  L  C  Q  D         p.440

          .         .         .         .         .         .       g.231960
 CCTACCAAGTTACTGCAGAATGGATGGTGTGTGCACAGCTGTGGACTGGGTTTTTACCAA       c.1380
 P  T  K  L  L  Q  N  G  W  C  V  H  S  C  G  L  G  F  Y  Q         p.460

          .          | 14        .         .         .         .    g.233876
 GCTGGCAGTCTCTGTTTAG | CCTGCCAGCCCCAGTGCTCCACGTGTACCAGTGGGCTGGAG    c.1440
 A  G  S  L  C  L  A |   C  Q  P  Q  C  S  T  C  T  S  G  L  E      p.480

          .         .         .         .         .         .       g.233936
 TGCTCATCCTGCCAGCCTCCCCTGCTGATGCGGCACGGGCAGTGTGTGCCTACCTGTGGG       c.1500
 C  S  S  C  Q  P  P  L  L  M  R  H  G  Q  C  V  P  T  C  G         p.500

          .         .         .     | 15   .         .         .    g.255522
 GACGGCTTCTACCAAGATCGCCATTCCTGTGCAG | TCTGCCATGAGTCCTGTGCAGGTTGC    c.1560
 D  G  F  Y  Q  D  R  H  S  C  A  V |   C  H  E  S  C  A  G  C      p.520

          .         .         .         .         .         .       g.255582
 TGGGGCCCAACGGAGAAGCACTGCTTGGCCTGCAGAGATCCCCTCCACGTGCTGAGAGAT       c.1620
 W  G  P  T  E  K  H  C  L  A  C  R  D  P  L  H  V  L  R  D         p.540

          .         .         .         .         .         | 16    g.263026
 GGCGGCTGTGAGAGCAGCTGTGGAAAAGGCTTCTACAACAGGCAGGGCACCTGTAGCG | CT    c.1680
 G  G  C  E  S  S  C  G  K  G  F  Y  N  R  Q  G  T  C  S  A |       p.560

          .         .         .         .         .         .       g.263086
 TGTGACCAATCCTGTGACAGTTGTGGCCCCAGTAGCCCCAGGTGTCTTACCTGTACTGAG       c.1740
 C  D  Q  S  C  D  S  C  G  P  S  S  P  R  C  L  T  C  T  E         p.580

          .         .         .         .         .         .       g.263146
 AAGACAGTGCTGCATGATGGGAAATGCATGTCTGAATGCCCTGGCGGGTACTATGCTGAT       c.1800
 K  T  V  L  H  D  G  K  C  M  S  E  C  P  G  G  Y  Y  A  D         p.600

          .          | 17        .         .         .         .    g.264839
 GCCACTGGCAGGTGCAAAG | TTTGTCATAACTCATGTGCCAGCTGCTCTGGGCCCACACCC    c.1860
 A  T  G  R  C  K  V |   C  H  N  S  C  A  S  C  S  G  P  T  P      p.620

          .         .         .         .         .         .       g.264899
 TCTCACTGTACAGCCTGCAGCCCCCCCAAGGCTCTGCGTCAAGGCCACTGTCTGCCCCGC       c.1920
 S  H  C  T  A  C  S  P  P  K  A  L  R  Q  G  H  C  L  P  R         p.640

          .         .         .         . | 18       .         .    g.266260
 TGTGGAGAGGGTTTCTACTCTGACCATGGAGTCTGCAAAG | CCTGTCACTCCTCCTGCCTG    c.1980
 C  G  E  G  F  Y  S  D  H  G  V  C  K  A |   C  H  S  S  C  L      p.660

          .         .         .         .         .         .       g.266320
 GCTTGTATGGGTCCCGCACCCTCTCACTGTACTGGGTGTAAGAAGCCAGAGGAAGGACTG       c.2040
 A  C  M  G  P  A  P  S  H  C  T  G  C  K  K  P  E  E  G  L         p.680

          .         .         .         .         .         .       g.266380
 CAAGTGGAGCAGCTGTCTGACGTGGGCATCCCCTCTGGCGAGTGTCTAGCCCAGTGTAGA       c.2100
 Q  V  E  Q  L  S  D  V  G  I  P  S  G  E  C  L  A  Q  C  R         p.700

          .         .         .        | 19.         .         .    g.280725
 GCCCATTTTTACTTGGAGAGCACTGGCATATGTGAAG | CTTGCCACCAGTCCTGTTTCAGA    c.2160
 A  H  F  Y  L  E  S  T  G  I  C  E  A |   C  H  Q  S  C  F  R      p.720

          .         .         .         .         .         .       g.280785
 TGTGCAGGGAAAAGCCCACATAACTGCACAGACTGTGGGCCTTCCCATGTGCTGTTGGAT       c.2220
 C  A  G  K  S  P  H  N  C  T  D  C  G  P  S  H  V  L  L  D         p.740

          .         .         .         .         .         | 20    g.285106
 GGGCAGTGCCTCTCCCAGTGCCCAGATGGCTACTTTCACCAGGAAGGTAGTTGCACAG | AG    c.2280
 G  Q  C  L  S  Q  C  P  D  G  Y  F  H  Q  E  G  S  C  T  E |       p.760

          .         .         .         .         .         .       g.285166
 TGTCACCCAACCTGCAGGCAGTGTCATGGGCCGTTGGAGTCTGACTGCATCTCCTGTTAC       c.2340
 C  H  P  T  C  R  Q  C  H  G  P  L  E  S  D  C  I  S  C  Y         p.780

          .         .         .         .         .         .       g.285226
 CCTCACATCTCTCTTACCAATGGTAACTGCAGGACCAGCTGCAGGGAAGAGCAGTTCCTC       c.2400
 P  H  I  S  L  T  N  G  N  C  R  T  S  C  R  E  E  Q  F  L         p.800

          .         .   | 21     .         .         .         .    g.310981
 AACCTCGTGGGATACTGTGCTG | ACTGCCATCACCTGTGCCAGCACTGTGCAGCTGATCTC    c.2460
 N  L  V  G  Y  C  A  D |   C  H  H  L  C  Q  H  C  A  A  D  L      p.820

          .         .         .         .         .         .       g.311041
 CACAACACTGGGAGCATCTGCCTCAGGTGCCAGAATGCCCACTACCTGCTGCTCGGGGAC       c.2520
 H  N  T  G  S  I  C  L  R  C  Q  N  A  H  Y  L  L  L  G  D         p.840

          .         .         .         .         .      | 22  .    g.311343
 CACTGTGTTCCTGACTGCCCTTCAGGATACTATGCAGAGAGAGGAGCTTGTAAAA | AATGC    c.2580
 H  C  V  P  D  C  P  S  G  Y  Y  A  E  R  G  A  C  K  K |   C      p.860

          .         .         .         .         .         .       g.311403
 CACTCCTCCTGCAGAACCTGCCAGGGCAGAGGACCTTTCTCCTGCTCCTCATGTGACACC       c.2640
 H  S  S  C  R  T  C  Q  G  R  G  P  F  S  C  S  S  C  D  T         p.880

          .         .         .         .         .         .       g.311463
 AACCTCGTGCTGTCCCACACTGGCACCTGCAGCACCACCTGCTTCCCTGGGCACTATCTT       c.2700
 N  L  V  L  S  H  T  G  T  C  S  T  T  C  F  P  G  H  Y  L         p.900

          .         .   | 23     .         .         .         .    g.317306
 GATGACAATCATGTTTGCCAGC | CATGCAACACACACTGTGGAAGCTGTGATTCACAGGCC    c.2760
 D  D  N  H  V  C  Q  P |   C  N  T  H  C  G  S  C  D  S  Q  A      p.920

          .         .         .         .         .         .       g.317366
 AGCTGTACCTCCTGCCGAGATCCAAACAAGGTTCTGCTCTTTGGGGAATGTCAATACGAG       c.2820
 S  C  T  S  C  R  D  P  N  K  V  L  L  F  G  E  C  Q  Y  E         p.940

          .         .         .         .          | 24        .    g.320159
 AGCTGCGCCCCACAGTACTATCTTGACTTCTCCACCAACACGTGCAAAG | AGTGTGATTGG    c.2880
 S  C  A  P  Q  Y  Y  L  D  F  S  T  N  T  C  K  E |   C  D  W      p.960

          .         .         .         .         .         .       g.320219
 AGCTGCAGTGCATGCAGTGGGCCCCTGAAAACAGACTGCCTGCAGTGCATGGATGGCTAT       c.2940
 S  C  S  A  C  S  G  P  L  K  T  D  C  L  Q  C  M  D  G  Y         p.980

          .         .         .         .         .         .       g.320279
 GTTCTCCAGGATGGGGCCTGCGTGGAGCAGTGCTTGTCATCATTTTACCAGGACTCGGGC       c.3000
 V  L  Q  D  G  A  C  V  E  Q  C  L  S  S  F  Y  Q  D  S  G         p.1000

          . | 25       .         .         .         .         .    g.321591
 CTCTGCAAGA | ACTGTGACAGCTACTGTCTCCAGTGCCAAGGTCCCCATGAGTGTACCCGC    c.3060
 L  C  K  N |   C  D  S  Y  C  L  Q  C  Q  G  P  H  E  C  T  R      p.1020

          .         .         .         .         .         .       g.321651
 TGCAAAGGGCCATTTCTCCTCTTGGAAGCCCAGTGTGTCCAGGAATGTGGGAAGGGGTAC       c.3120
 C  K  G  P  F  L  L  L  E  A  Q  C  V  Q  E  C  G  K  G  Y         p.1040

          .         .         .  | 26      .         .         .    g.323198
 TTTGCAGATCATGCAAAGCACAAATGCACAG | CCTGCCCTCAGGGGTGCTTGCAGTGCAGC    c.3180
 F  A  D  H  A  K  H  K  C  T  A |   C  P  Q  G  C  L  Q  C  S      p.1060

          .         .         .         .         .         .       g.323258
 CACAGGGACCGTTGTCACCTCTGTGACCATGGGTTCTTTCTGAAGAGTGGCCTCTGTGTT       c.3240
 H  R  D  R  C  H  L  C  D  H  G  F  F  L  K  S  G  L  C  V         p.1080

          .         .         .         .         .   | 27     .    g.327164
 TACAACTGTGTTCCTGGCTTTTCTGTCCACACCTCTAATGAAACATGTTCTG | GCAAAATA    c.3300
 Y  N  C  V  P  G  F  S  V  H  T  S  N  E  T  C  S  G |   K  I      p.1100

          .         .         .         .         .         .       g.327224
 CACACCCCTAGTCTTCATGTGAATGGTTCCCTGATCCTCCCAATTGGTTCAATAAAGCCA       c.3360
 H  T  P  S  L  H  V  N  G  S  L  I  L  P  I  G  S  I  K  P         p.1120

          .         .         .         .         .         .       g.327284
 CTGGATTTTTCCCTCCTGAATGTCCAAGACCAGGAGGGTAGGGTCGAAGATCTCCTATTT       c.3420
 L  D  F  S  L  L  N  V  Q  D  Q  E  G  R  V  E  D  L  L  F         p.1140

          .         .         .         .         .         .       g.327344
 CATGTTGTGAGCACTCCCACCAATGGTCAGCTAGTGCTCTCAAGAAATGGAAAAGAGGTT       c.3480
 H  V  V  S  T  P  T  N  G  Q  L  V  L  S  R  N  G  K  E  V         p.1160

          .         .         .         .         .         .       g.327404
 CAGCTGGACAAGGCTGGCCGTTTTAGCTGGAAAGATGTGAACGAGAAGAAAGTGCGTTTT       c.3540
 Q  L  D  K  A  G  R  F  S  W  K  D  V  N  E  K  K  V  R  F         p.1180

          .         .    | 28    .         .         .         .    g.331526
 GTGCACAGCAAAGAAAAACTCAG | GAAAGGTTACCTTTTCCTGAAAATTAGTGACCAGCAG    c.3600
 V  H  S  K  E  K  L  R  |  K  G  Y  L  F  L  K  I  S  D  Q  Q      p.1200

          .         .         .         .         | 29         .    g.334817
 TTCTTCTCTGAGCCACAGCTGATCAACATACAAGCATTTTCAACACAG | GCCCCCTATGTG    c.3660
 F  F  S  E  P  Q  L  I  N  I  Q  A  F  S  T  Q   | A  P  Y  V      p.1220

          .         .         .         .         .         .       g.334877
 CTGAGAAATGAAGTTCTCCACATTAGCAGAGGAGAGAGGGCAACCATCACCACCCAGATG       c.3720
 L  R  N  E  V  L  H  I  S  R  G  E  R  A  T  I  T  T  Q  M         p.1240

          .         .         .         .         .         .       g.334937
 CTTGACATCCGAGATGATGACAACCCACAGGATGTGGTCATTGAAATAATCGATCCTCCA       c.3780
 L  D  I  R  D  D  D  N  P  Q  D  V  V  I  E  I  I  D  P  P         p.1260

          .         .         .         .         .         .       g.334997
 CTTCATGGCCAATTGCTTCAGACACTTCAGTCCCCGGCAACCCCTATCTATCAATTCCAG       c.3840
 L  H  G  Q  L  L  Q  T  L  Q  S  P  A  T  P  I  Y  Q  F  Q         p.1280

          .         .         .         .         .         .       g.335057
 CTGGATGAACTCTCTAGAGGCCTTCTCCACTATGCTCATGATGGTTCAGACAGCACATCC       c.3900
 L  D  E  L  S  R  G  L  L  H  Y  A  H  D  G  S  D  S  T  S         p.1300

          .         .         .         .         .         .       g.335117
 GATGTTGCAGTCTTGCAGGCCAATGATGGACACTCCTTCCATAATATACTGTTCCAAGTG       c.3960
 D  V  A  V  L  Q  A  N  D  G  H  S  F  H  N  I  L  F  Q  V         p.1320

          .      | 30  .         .         .         .         .    g.348209
 AAGACCGTGCCTCAG | AATGACAGGGGTCTTCAGCTTGTGGCTAATTCGATGGTGTGGGTT    c.4020
 K  T  V  P  Q   | N  D  R  G  L  Q  L  V  A  N  S  M  V  W  V      p.1340

          .         .         .         .         .         .       g.348269
 CCAGAAGGGGGGATGCTGCAGATCACCAACAGAATCTTACAGGCCGAGGCTCCTGGTGCC       c.4080
 P  E  G  G  M  L  Q  I  T  N  R  I  L  Q  A  E  A  P  G  A         p.1360

          .         .         .         .          | 31        .    g.355104
 AGTGCTGAAGAAATCATCTACAAGATTACACAAGACTACCCCCAGTTTG | GGGAGGTGGTC    c.4140
 S  A  E  E  I  I  Y  K  I  T  Q  D  Y  P  Q  F  G |   E  V  V      p.1380

          .         .         .         .         .         .       g.355164
 CTTCTAGTGAATATGCCTGCAGACAGCCCTGCAGATGAAGGGCAGCACCTGCCTGATGGG       c.4200
 L  L  V  N  M  P  A  D  S  P  A  D  E  G  Q  H  L  P  D  G         p.1400

          .         .         .         .         .         .       g.355224
 AGGACAGCTACCCCCACCAGCACCTTCACCCAGCAGGACATCAATGAAGGCATCGTATGG       c.4260
 R  T  A  T  P  T  S  T  F  T  Q  Q  D  I  N  E  G  I  V  W         p.1420

          .         .         .         .         | 32         .    g.360411
 TACAGGCACTCAGGAGCCCCAGCCCAGAGCGACTCCTTCCGCTTCGAG | GTGTCCAGTGCC    c.4320
 Y  R  H  S  G  A  P  A  Q  S  D  S  F  R  F  E   | V  S  S  A      p.1440

          .         .         .         .         .         .       g.360471
 TCCAATGCCCAGACCCGCCTGGAGAGCCACATGTTCAACATCGCGATCTTACCACAGACA       c.4380
 S  N  A  Q  T  R  L  E  S  H  M  F  N  I  A  I  L  P  Q  T         p.1460

          .         .         .         .      | 33  .         .    g.366394
 CCTGAAGCACCTAAAGTGTCTCTGGAAGCATCTCTCCATATGACT | GCTAGAGAAGATGGC    c.4440
 P  E  A  P  K  V  S  L  E  A  S  L  H  M  T   | A  R  E  D  G      p.1480

          .         .         .         .         .         .       g.366454
 CTGACTGTTATTCAGCCTCATTCCCTCTCCTTCATAAACTCTGAGAAGCCAAGTGGAAAG       c.4500
 L  T  V  I  Q  P  H  S  L  S  F  I  N  S  E  K  P  S  G  K         p.1500

          .         .         .         . | 34       .         .    g.369313
 ATTGTCTACAACATCACTCTACCTCTGCATCCAAATCAAG | GTATCATCGAGCACCGGGAC    c.4560
 I  V  Y  N  I  T  L  P  L  H  P  N  Q  G |   I  I  E  H  R  D      p.1520

          .         .         .         .         .         .       g.369373
 CACCCTCACTCTCCTATCCGGTATTTCACGCAAGAGGATATTAACCAGGGCAAAGTCATG       c.4620
 H  P  H  S  P  I  R  Y  F  T  Q  E  D  I  N  Q  G  K  V  M         p.1540

          .         .         .         .         .         | 35    g.371820
 TACCGCCCTCCCCCGGCAGCACCCCACCTCCAGGAGCTCATGGCCTTCTCGTTCGCTG | GT    c.4680
 Y  R  P  P  P  A  A  P  H  L  Q  E  L  M  A  F  S  F  A  G |       p.1560

          .         .         .  | 36      .         .         .    g.376554
 CTCCCAGAATCAGTGAAATTCCACTTCACAG | TTTCAGATGGAGAACACACAAGTCCGGAG    c.4740
 L  P  E  S  V  K  F  H  F  T  V |   S  D  G  E  H  T  S  P  E      p.1580

          .         .         .         .         .         .       g.376614
 ATGGTCCTCACCATTCACTTACTTCCCAGTGATCAGCAACTGCCAGTGTTCCAGGTCACA       c.4800
 M  V  L  T  I  H  L  L  P  S  D  Q  Q  L  P  V  F  Q  V  T         p.1600

          .         .         .         .    | 37    .         .    g.377739
 GCTCCACGGCTGGCGGTCAGCCCAGGAGGCAGCACTTCTGTAG | GACTTCAGGTGGTAGTA    c.4860
 A  P  R  L  A  V  S  P  G  G  S  T  S  V  G |   L  Q  V  V  V      p.1620

          .         .         .         .         .         .       g.377799
 AGAGATGCTGAGACAGCGCCCAAAGAACTCTTCTTTGAGCTTCGGAGACCTCCACAGCAT       c.4920
 R  D  A  E  T  A  P  K  E  L  F  F  E  L  R  R  P  P  Q  H         p.1640

          .         .         .         .          | 38        .    g.379798
 GGTGTGCTTCTTAAGCATACAGCTGAGTTCCGAAGGCCGATGGCCACAG | GTGACACTTTC    c.4980
 G  V  L  L  K  H  T  A  E  F  R  R  P  M  A  T  G |   D  T  F      p.1660

          .         .         .         .         .         .       g.379858
 ACCTATGAGGATGTTGAGAAAAATGCTCTACAGTATATACATGATGGTTCCTCTACCCGG       c.5040
 T  Y  E  D  V  E  K  N  A  L  Q  Y  I  H  D  G  S  S  T  R         p.1680

          .         .         .         .         .         .       g.379918
 GAAGACAGCATGGAGATCTCAGTCACAGATGGCCTCACAGTGACAATGCTGGAGGTGAGA       c.5100
 E  D  S  M  E  I  S  V  T  D  G  L  T  V  T  M  L  E  V  R         p.1700

          .         .         .         .         .         .       g.379978
 GTAGAGGTGTCCCTGTCAGAAGACCGAGGGCCTCGACTGGCTGCTGGCTCCTCTCTGAGC       c.5160
 V  E  V  S  L  S  E  D  R  G  P  R  L  A  A  G  S  S  L  S         p.1720

          .         .         .         .         .        | 39.    g.386003
 ATTACTGTTGCCAGTAAAAGCACAGCCATAATCACTAGGTCACACCTTGCTTACGTG | GAT    c.5220
 I  T  V  A  S  K  S  T  A  I  I  T  R  S  H  L  A  Y  V   | D      p.1740

          .         .         .         .         .         .       g.386063
 GATTCTTCCCCCGACCCAGAGATCTGGATTCAGTTAAATTATCTGCCCTCATATGGTACT       c.5280
 D  S  S  P  D  P  E  I  W  I  Q  L  N  Y  L  P  S  Y  G  T         p.1760

          .         .         .         .         .         .       g.386123
 CTCTTAAGAATCTCAGGATCTGAGGTGGAAGAGCTCTCAGAAGTTTCCAATTTCACAATG       c.5340
 L  L  R  I  S  G  S  E  V  E  E  L  S  E  V  S  N  F  T  M         p.1780

          .         .       | 40 .         .         .         .    g.386366
 GAAGACATCAATAACAAGAAAATCAG | ATACTCAGCTGTGTTTGAAACTGATGGTCATCTG    c.5400
 E  D  I  N  N  K  K  I  R  |  Y  S  A  V  F  E  T  D  G  H  L      p.1800

          .         .         .         .         .         .       g.386426
 GTTACTGATAGCTTCTATTTCTCTGTCTCTGACATGGACCACAACCATCTGGATAATCAG       c.5460
 V  T  D  S  F  Y  F  S  V  S  D  M  D  H  N  H  L  D  N  Q         p.1820

          .         .         .         .         .         .       g.386486
 ATATTTACCATCATGATCACTCCTGCTGAAAATCCACCTCCAGTCATTGCTTTTGCTGAC       c.5520
 I  F  T  I  M  I  T  P  A  E  N  P  P  P  V  I  A  F  A  D         p.1840

           | 41        .         .         .         .         .    g.388643
 CTTATCACG | GTTGATGAGGGAGGGAGAGCACCACTCTCATTTCACCATTTTTTTGCTACT    c.5580
 L  I  T   | V  D  E  G  G  R  A  P  L  S  F  H  H  F  F  A  T      p.1860

          .         .         .         .         .         .       g.388703
 GATGATGATGACAACCTCCAGAGAGATGCCATCATTAAACTAAGTGCTCTGCCCAAATAT       c.5640
 D  D  D  D  N  L  Q  R  D  A  I  I  K  L  S  A  L  P  K  Y         p.1880

          .         .      | 42  .         .         .         .    g.392987
 GGCTGCATTGAGAACACAGGAACAG | GTGATCGTTTTGGCCCTGAAACTGCCAGTGACCTA    c.5700
 G  C  I  E  N  T  G  T  G |   D  R  F  G  P  E  T  A  S  D  L      p.1900

          .         .         .         .         .         .       g.393047
 GAGGCATCATTTCCTATTCAAGACGTCCTGGAAAACTACATTTACTACTTTCAGAGTGTT       c.5760
 E  A  S  F  P  I  Q  D  V  L  E  N  Y  I  Y  Y  F  Q  S  V         p.1920

          .         .         .         .         .         .       g.393107
 CATGAAAGCATTGAGCCAACCCATGATATTTTTAGTTTTTATGTGAGTGATGGAACCAGT       c.5820
 H  E  S  I  E  P  T  H  D  I  F  S  F  Y  V  S  D  G  T  S         p.1940

          .         .         .       | 43 .         .         .    g.394181
 CGTTCAGAAATTCACAGCATCAATATCACCATTGAG | AGGAAGAACGATGAGCCTCCCAGG    c.5880
 R  S  E  I  H  S  I  N  I  T  I  E   | R  K  N  D  E  P  P  R      p.1960

          .         .         .         .         .         .       g.394241
 ATGACCTTGCAGCCCCTCAGAGTGCAGCTGAGCTCGGGAGTGGTGATAAGCAATTCTTCT       c.5940
 M  T  L  Q  P  L  R  V  Q  L  S  S  G  V  V  I  S  N  S  S         p.1980

          .         .         .         .         .         .       g.394301
 TTGAGCCTGCAAGACCTGGACACCCCAGATAATGAGCTCATTTTTGTATTGACAAAAAAG       c.6000
 L  S  L  Q  D  L  D  T  P  D  N  E  L  I  F  V  L  T  K  K         p.2000

          . | 44       .         .         .         .         .    g.395533
 CCTGACCACG | GTCATGTACTCTGGAGGCAAACTGCTTCTGAGCCTCTGGAGAATGGGAGA    c.6060
 P  D  H  G |   H  V  L  W  R  Q  T  A  S  E  P  L  E  N  G  R      p.2020

          .         .         .         .         .         .       g.395593
 GTTTTAGTCCAGGGCTCAACCTTCACCTACCAGGATATCCTAGCTGGGCTGGTTGGGTAT       c.6120
 V  L  V  Q  G  S  T  F  T  Y  Q  D  I  L  A  G  L  V  G  Y         p.2040

          .         .         .         .         .         .       g.395653
 GTGCCTAGTGTCCCTGGCATGGTCGTGGATGAGTTCCAGTTCTCCCTCACTGATGGCCTC       c.6180
 V  P  S  V  P  G  M  V  V  D  E  F  Q  F  S  L  T  D  G  L         p.2060

          .         .         .         .         .         .       g.395713
 CACGTGGACACAGGGAGGATGAAGATCTACACAGAACTGCCTGCAAGTGACACACCTCAC       c.6240
 H  V  D  T  G  R  M  K  I  Y  T  E  L  P  A  S  D  T  P  H         p.2080

          .         .         .     | 45   .         .         .    g.397607
 TTGGCTATAAACCAAGGCCTACAGCTCTCAGCAG | GGTCTGTAGCACGCATCACAGAACAG    c.6300
 L  A  I  N  Q  G  L  Q  L  S  A  G |   S  V  A  R  I  T  E  Q      p.2100

          .         .         .         .         .         .       g.397667
 CACTTGAAAGTGACAGATATTGACTCAGATGACCATCAGGTTATGTACATCATGAAGGAA       c.6360
 H  L  K  V  T  D  I  D  S  D  D  H  Q  V  M  Y  I  M  K  E         p.2120

          .         .         .         .         .         .       g.397727
 GATCCTGGTGCAGGGCGCCTGCAGATGATGAAGCATGGCAACCTGGAGCAAATTTCTATT       c.6420
 D  P  G  A  G  R  L  Q  M  M  K  H  G  N  L  E  Q  I  S  I         p.2140

          .         .         .         .    | 46    .         .    g.399219
 AAAGGCCCCATCCGAAGTTTCACCCAGGCAGACATTAGCCAAG | GCCACGTAGAATATAGT    c.6480
 K  G  P  I  R  S  F  T  Q  A  D  I  S  Q  G |   H  V  E  Y  S      p.2160

          .         .         .         .         .         .       g.399279
 CATGGAACAGGAGAACCTGGAGGGAGCTTTGCTTTTAAATTTGATGTGGTTGATGGAGAA       c.6540
 H  G  T  G  E  P  G  G  S  F  A  F  K  F  D  V  V  D  G  E         p.2180

          .         .         .         .    | 47    .         .    g.399622
 GGCAACAGATTGATTGACAAGTCATTTTCCATCAGCATTCTAG | AAGACAAATCCCCACCA    c.6600
 G  N  R  L  I  D  K  S  F  S  I  S  I  L  E |   D  K  S  P  P      p.2200

          .         .         .         .         .         .       g.399682
 GTCATCACCACCAATAAAGGACTGGTCTTGGATGAAAACTCAGTGAAGAAAATCACCACC       c.6660
 V  I  T  T  N  K  G  L  V  L  D  E  N  S  V  K  K  I  T  T         p.2220

          .         .         .         .         .         .       g.399742
 CTGCAGCTGTCTGCCACTGACCAGGACAGTGGGCCTACAGAATTGATCTACAGAATCACC       c.6720
 L  Q  L  S  A  T  D  Q  D  S  G  P  T  E  L  I  Y  R  I  T         p.2240

          .         .         .         .    | 48    .         .    g.411468
 AGACAGCCCCAGCTGGGCCACTTGGAACATGCAGCATCACCAG | GTATCCAGATTAGTTCC    c.6780
 R  Q  P  Q  L  G  H  L  E  H  A  A  S  P  G |   I  Q  I  S  S      p.2260

          .         .         .         .         .         .       g.411528
 TTTACTCAAGCTGATCTGACTTCACGAAATGTTCAGTATGTCCATTCTAGTGAGGCTGAG       c.6840
 F  T  Q  A  D  L  T  S  R  N  V  Q  Y  V  H  S  S  E  A  E         p.2280

          .         .         .         .         | 49         .    g.411885
 AAACATTCAGATGCCTTCAGCTTTACACTGTCTGATGGAGTCAGTGAG | GTGACTCAGACT    c.6900
 K  H  S  D  A  F  S  F  T  L  S  D  G  V  S  E   | V  T  Q  T      p.2300

          .         .         .         .         .         .       g.411945
 TTCCATATCACTCTTCACCCTGTCGATGATTCGCTGCCCGTCGTACAGAACTTAGGAATG       c.6960
 F  H  I  T  L  H  P  V  D  D  S  L  P  V  V  Q  N  L  G  M         p.2320

          .         .         .         .         .         .       g.412005
 CGGGTGCAGGAGGGCATGAGGAAGACCATCACAGAGTTTGAGCTTAAGGCGGTGGATGCT       c.7020
 R  V  Q  E  G  M  R  K  T  I  T  E  F  E  L  K  A  V  D  A         p.2340

           | 50        .         .         .         .         .    g.413689
 GACACAGAG | GCCGAGTCTGTCACATTCACCATCGTGCAGCCTCCACGCCATGGCACCATC    c.7080
 D  T  E   | A  E  S  V  T  F  T  I  V  Q  P  P  R  H  G  T  I      p.2360

          .         .         .         .         .         .       g.413749
 GAGCGAACCAGCAATGGGCAGCATTTCCACCTCACCTCCACCTTCACCATGAAAGATATC       c.7140
 E  R  T  S  N  G  Q  H  F  H  L  T  S  T  F  T  M  K  D  I         p.2380

          .         .         .         .         .         .       g.413809
 TACCAGAACCGGGTCAGCTACAGCCATGACGGCAGTAACTCCCTCAAGGACCGGTTCACC       c.7200
 Y  Q  N  R  V  S  Y  S  H  D  G  S  N  S  L  K  D  R  F  T         p.2400

          .         .         .         .         .        | 51.    g.417411
 TTCACTGTTTCTGATGGGACAAACCCCTTCTTTATCATTGAGGAAGGGGGAAAAGAG | ATT    c.7260
 F  T  V  S  D  G  T  N  P  F  F  I  I  E  E  G  G  K  E   | I      p.2420

          .         .         .         .         .         .       g.417471
 ATGACAGCAGCACCTCAGCCGTTCCGAGTAGACATCCTCCCGGTAGATGATGGCACGCCT       c.7320
 M  T  A  A  P  Q  P  F  R  V  D  I  L  P  V  D  D  G  T  P         p.2440

          .         .         .         .         .  | 52      .    g.419619
 AGAATTGTCACCAACCTGGGACTCCAGTGGCTGGAATACATGGATGGCAAG | GCAACCAAC    c.7380
 R  I  V  T  N  L  G  L  Q  W  L  E  Y  M  D  G  K   | A  T  N      p.2460

          .         .         .         .         .         .       g.419679
 CTGATCACCAAGAAGGAACTGCTGACCATGGACCCAGACACCGAGGACGCGCAGCTTGTC       c.7440
 L  I  T  K  K  E  L  L  T  M  D  P  D  T  E  D  A  Q  L  V         p.2480

          .         .         .         .         .         .       g.419739
 TATGAGATAACGACGGGCCCTAAGCATGGCTTTGTGGAGAACAAGCTGCAGCCTGGCAGA       c.7500
 Y  E  I  T  T  G  P  K  H  G  F  V  E  N  K  L  Q  P  G  R         p.2500

          .         .   | 53     .         .         .         .    g.420906
 GCTGCTGCCACTTTCACCCAGG | AGGATGTGAACTTGGGGTTGATTCGTTATGTGTTGCAC    c.7560
 A  A  A  T  F  T  Q  E |   D  V  N  L  G  L  I  R  Y  V  L  H      p.2520

          .         .         .         .         .         .       g.420966
 AAGGAGAAGATCCGTGAGATGATGGATAGTTTTCAGTTTCTGGTGAAAGACAGTAAACCC       c.7620
 K  E  K  I  R  E  M  M  D  S  F  Q  F  L  V  K  D  S  K  P         p.2540

          .         .         .         .         .         .       g.421026
 AATGTGGTCAGCGACAATGTCTTCCATATCCAGTGGTCACTCATCAGCTTTAAATATACC       c.7680
 N  V  V  S  D  N  V  F  H  I  Q  W  S  L  I  S  F  K  Y  T         p.2560

    | 54     .         .         .         .         .         .    g.422926
 AG | CTACAATGTCAGTGAGAAGGCAGGGTCTGTCAGTGTCACGGTGCAGAGGACTGGGAAC    c.7740
 S  |  Y  N  V  S  E  K  A  G  S  V  S  V  T  V  Q  R  T  G  N      p.2580

          .         .         .         .         .         .       g.422986
 CTGAACCAATATGCCATCGTCCTGTGTCGCACCGAGCAAGGCACCGCCAGCTCCAGCTCC       c.7800
 L  N  Q  Y  A  I  V  L  C  R  T  E  Q  G  T  A  S  S  S  S         p.2600

          .         .         .         .         .  | 55      .    g.425254
 AGGGTCAGCTCCCAACCTGGGCAACAGGACTATGTAGAGTATGCTGGCCAG | GTCCAGTTT    c.7860
 R  V  S  S  Q  P  G  Q  Q  D  Y  V  E  Y  A  G  Q   | V  Q  F      p.2620

          .         .         .         .         .         .       g.425314
 GATGAGCGAGAGGACACCAAGTCCTGCACCATTGTCATCAACGATGATGACGTGTTTGAA       c.7920
 D  E  R  E  D  T  K  S  C  T  I  V  I  N  D  D  D  V  F  E         p.2640

          .         .         .         .         .         .       g.425374
 AATGTTGAGAGTTTCACTGTGGAGCTCAGCATGCCAGCTTATGCCCTGTTAGGGGAATTC       c.7980
 N  V  E  S  F  T  V  E  L  S  M  P  A  Y  A  L  L  G  E  F         p.2660

          .         .         .         .         .         .       g.425434
 ACCCAGGCGAAGGTCATTATCAACGATACCGAGGATGAACCCACATTAGAGTTTGACAAG       c.8040
 T  Q  A  K  V  I  I  N  D  T  E  D  E  P  T  L  E  F  D  K         p.2680

          .         .         .         .         .         | 56    g.426806
 AAGATCTACTGGGTTAACGAGAGCGCTGGTTTTCTGTTTGCACCTATTGAAAGAAAAG | GA    c.8100
 K  I  Y  W  V  N  E  S  A  G  F  L  F  A  P  I  E  R  K  G |       p.2700

          .         .         .         .         .         .       g.426866
 GATGCAAGCAGCATTGTATCTGCAATTTGCTACACAGTCCCTAAGTCAGCTATGGGAAGT       c.8160
 D  A  S  S  I  V  S  A  I  C  Y  T  V  P  K  S  A  M  G  S         p.2720

          .         .         .         .         .         .       g.426926
 AGCCTCTATGCTCTAGAATCAGGCTCTGATTTTAAATCTAGAGGGATGTCTGCCGCGAGT       c.8220
 S  L  Y  A  L  E  S  G  S  D  F  K  S  R  G  M  S  A  A  S         p.2740

          .         .         .         .         .         .       g.426986
 CGTGTGATATTCGGGCCTGGTGTGACCATGTCCACCTGTGATGTCATGCTTATTGATGAC       c.8280
 R  V  I  F  G  P  G  V  T  M  S  T  C  D  V  M  L  I  D  D         p.2760

          .         .         .         .         .         .       g.427046
 AGCGAGTATGAAGAGGAAGAAGAGTTTGAGATTGCCTTGGCAGATGCCTCTGACAATGCC       c.8340
 S  E  Y  E  E  E  E  E  F  E  I  A  L  A  D  A  S  D  N  A         p.2780

          .         .         .         .         .         .       g.427106
 CGCATTGGAAGGGTGGCGACAGCCAAGGTGCTCATTAGTGGTCCCAACGATGCCTCGACT       c.8400
 R  I  G  R  V  A  T  A  K  V  L  I  S  G  P  N  D  A  S  T         p.2800

          .         .         .         .    | 57    .         .    g.429251
 GTGTCCCTGGGCAACACGGCTTTCACTGTCAGTGAGGACGCAG | GCACAGTAAAGATTCCA    c.8460
 V  S  L  G  N  T  A  F  T  V  S  E  D  A  G |   T  V  K  I  P      p.2820

          .         .         .         .         .         .       g.429311
 GTTATCCGCCATGGTACTGACCTCTCTACTTTCGCATCTGTCTGGTGTGCAACGCGGCCC       c.8520
 V  I  R  H  G  T  D  L  S  T  F  A  S  V  W  C  A  T  R  P         p.2840

          .         .         .         .         .         .       g.429371
 TCAGACCCAGCTTCTGCCACACCAGGAGTTGACTACGTTCCCAGCTCTCGGAAGGTGGAA       c.8580
 S  D  P  A  S  A  T  P  G  V  D  Y  V  P  S  S  R  K  V  E         p.2860

          .         .     | 58   .         .         .         .    g.429854
 TTTGGGCCTGGTGTCATTGAACAG | TATTGCACCTTGACTATCTTGGATGACACTCAGTAT    c.8640
 F  G  P  G  V  I  E  Q   | Y  C  T  L  T  I  L  D  D  T  Q  Y      p.2880

          .         .         .         .         .         .       g.429914
 CCGGTAATTGAAGGACTGGAGACATTTGTGGTTTTCCTCAGCTCAGCACAAGGAGCCGAA       c.8700
 P  V  I  E  G  L  E  T  F  V  V  F  L  S  S  A  Q  G  A  E         p.2900

          .         .         .         .         .   | 59     .    g.436313
 CTGACCAAACCCTTCCAGGCAGTCATTGCAATTAATGACACATTCCAAGATG | TGCCCAGC    c.8760
 L  T  K  P  F  Q  A  V  I  A  I  N  D  T  F  Q  D  V |   P  S      p.2920

          .         .         .         .         .         .       g.436373
 ATGCAGTTTGCCAAGGATTTGCTCCTAGTGAAGGAGAAGGAGGGTGTCCTGCATGTCCCT       c.8820
 M  Q  F  A  K  D  L  L  L  V  K  E  K  E  G  V  L  H  V  P         p.2940

          .         .         .         .         .         .       g.436433
 ATCACTCGGAGCGGAGACCTGAGCTATGAGTCATCAGTGAGGTGCTATACTCAGAGCCAT       c.8880
 I  T  R  S  G  D  L  S  Y  E  S  S  V  R  C  Y  T  Q  S  H         p.2960

          .         .         .         .         .         .       g.436493
 TCCGCTCAGGTCATGGAGGACTTTGAGGAGAGACAAAATGCAGACTCTTCACGGATTACA       c.8940
 S  A  Q  V  M  E  D  F  E  E  R  Q  N  A  D  S  S  R  I  T         p.2980

          .         | 60         .         .         .         .    g.444277
 TTTCTCAAAGGGGACAAA | GTGAAGAACTGTACGGTCTATATCCACGATGACTCCATGTTT    c.9000
 F  L  K  G  D  K   | V  K  N  C  T  V  Y  I  H  D  D  S  M  F      p.3000

          .         .         .         .         .         .       g.444337
 GAGCCAGAGGAACAGTTCAGGGTCTACCTCGGCCTTCCTCTTGGAAACCACTGGAGTGGA       c.9060
 E  P  E  E  Q  F  R  V  Y  L  G  L  P  L  G  N  H  W  S  G         p.3020

          .         .         .         .         .      | 61  .    g.447156
 GCTAGAATTGGAAAGAATAACATGGCCACCATCACCATATCCAATGATGAAGATG | CCCCC    c.9120
 A  R  I  G  K  N  N  M  A  T  I  T  I  S  N  D  E  D  A |   P      p.3040

          .         .         .         .         .         .       g.447216
 ACCATTGAGTTTGAAGAAGCTGCATACCAAGTCCGGGAACCCGCAGGCCCAGATGCCATT       c.9180
 T  I  E  F  E  E  A  A  Y  Q  V  R  E  P  A  G  P  D  A  I         p.3060

          .         .         .         .         .         .       g.447276
 GCGATTCTGAACATCAAGGTGATCCGCAGAGGGGATCAGAACAGGACCTCCAAGGTTCGC       c.9240
 A  I  L  N  I  K  V  I  R  R  G  D  Q  N  R  T  S  K  V  R         p.3080

          .         .         .         .         .         .       g.447336
 TGCAGCACGCGGGATGGCTCTGCCCAGTCTGGTGTGGATTATTACCCAAAGAGCCGAGTC       c.9300
 C  S  T  R  D  G  S  A  Q  S  G  V  D  Y  Y  P  K  S  R  V         p.3100

          .       | 62 .         .         .         .         .    g.454895
 TTGAAGTTCAGTCCCG | GTGTGGATCATATCTTTTTTAAAGTTGAGATCCTGTCCAATGAA    c.9360
 L  K  F  S  P  G |   V  D  H  I  F  F  K  V  E  I  L  S  N  E      p.3120

          .         .         .         .         .         .       g.454955
 GACCGGGAATGGCATGAATCTTTCTCACTAGTCCTTGGCCCAGATGACCCAGTGGAAGCA       c.9420
 D  R  E  W  H  E  S  F  S  L  V  L  G  P  D  D  P  V  E  A         p.3140

          .         .         .         .         .         .       g.455015
 GTTCTTGGGGATGTGACTACTGCCACGGTGACAATTCTAGACCAGGAGGCAGCAGGGAGC       c.9480
 V  L  G  D  V  T  T  A  T  V  T  I  L  D  Q  E  A  A  G  S         p.3160

          .         .     | 63   .         .         .         .    g.456197
 CTCATATTGCCAGCACCACCCATT | GTGGTCACACTTGCTGACTATGACCATGTGGAAGAA    c.9540
 L  I  L  P  A  P  P  I   | V  V  T  L  A  D  Y  D  H  V  E  E      p.3180

          .         .         .         .         .         .       g.456257
 GTTACCAAGGAAGGAGTCAAGAAATCCCCCTCCCCAGGCTACCCACTGGTCTGTGTCACC       c.9600
 V  T  K  E  G  V  K  K  S  P  S  P  G  Y  P  L  V  C  V  T         p.3200

          .         .         .         .         .         .       g.456317
 CCCTGCGACCCTCATTTCCCCAGATACGCTGTCATGAAGGAGCGCTGCAGTGAGGCCGGC       c.9660
 P  C  D  P  H  F  P  R  Y  A  V  M  K  E  R  C  S  E  A  G         p.3220

          .         .         .         .         .         .       g.456377
 ATCAACCAGACATCTGTGCAGTTCAGCTGGGAAGTGGCTGCCCCCACTGATGGCAATGGG       c.9720
 I  N  Q  T  S  V  Q  F  S  W  E  V  A  A  P  T  D  G  N  G         p.3240

          .         .         .         .         .         .       g.456437
 GCCCGGTCTCCCTTTGAAACCATCACTGACAACACACCATTCACCAGTGTCAACCACATG       c.9780
 A  R  S  P  F  E  T  I  T  D  N  T  P  F  T  S  V  N  H  M         p.3260

  | 64       .         .         .         .         .         .    g.458764
  | GTCCTGGACAGCATTTACTTCAGCCGGAGGTTCCATGTGCGTTGTGTGGCCAAGGCTGTG    c.9840
  | V  L  D  S  I  Y  F  S  R  R  F  H  V  R  C  V  A  K  A  V      p.3280

          .         .         .         .         .         .       g.458824
 GACAAGGTGGGCCATGTGGGGACCCCCTTAAGGAGCAACATTGTTACCATTGGAACAGAC       c.9900
 D  K  V  G  H  V  G  T  P  L  R  S  N  I  V  T  I  G  T  D         p.3300

          .         .         .         .         .         .       g.458884
 AGTGCTATCTGCCACACACCAGTGGTGGCTGGGACATCCAGAGGCTTCCAGGCTCAGTCC       c.9960
 S  A  I  C  H  T  P  V  V  A  G  T  S  R  G  F  Q  A  Q  S         p.3320

          .         .         .         .         .    | 65    .    g.460829
 TTCATCGCAACCTTGAAATACCTGGATGTCAAACATAAGGAGCATCCGAACAG | AATCCAC    c.10020
 F  I  A  T  L  K  Y  L  D  V  K  H  K  E  H  P  N  R  |  I  H      p.3340

          .         .         .         .         .         .       g.460889
 ATTTCGGTGCAGATCCCACACCAGGATGGAATGCTGCCCCTTATCTCCACCATGCCGTTG       c.10080
 I  S  V  Q  I  P  H  Q  D  G  M  L  P  L  I  S  T  M  P  L         p.3360

          .         .         .         .         .         .       g.460949
 CACAACTTACATTTTCTACTGTCTGAGTCCATCTACAGACACCAGCACGTCTGCTCCAAT       c.10140
 H  N  L  H  F  L  L  S  E  S  I  Y  R  H  Q  H  V  C  S  N         p.3380

          .         .         .     | 66   .         .         .    g.463255
 TTAGTTACCACCTATGACCTGAGAGGCATCTCAG | AGGCAGGGTTCCTGGATGATGTGGTC    c.10200
 L  V  T  T  Y  D  L  R  G  I  S  E |   A  G  F  L  D  D  V  V      p.3400

          .         .         .         .         .         .       g.463315
 TATGATAGCACTGCCCTGGGGCCTGGCTACGATCGCCCCTTCCAGTTTGACCCCAGCGTG       c.10260
 Y  D  S  T  A  L  G  P  G  Y  D  R  P  F  Q  F  D  P  S  V         p.3420

          .         .         .         .         .         .       g.463375
 CGAGAGCCGAAGACCATCCAGCTCTACAAACACCTGAACCTGAAGAGCTGCGTGTGGACC       c.10320
 R  E  P  K  T  I  Q  L  Y  K  H  L  N  L  K  S  C  V  W  T         p.3440

          .         .         .         .         .         .       g.463435
 TTTGATGCTTATTATGACATGACTGAGCTGATTGACGTCTGTGGGGGCTCTGTAACCGCT       c.10380
 F  D  A  Y  Y  D  M  T  E  L  I  D  V  C  G  G  S  V  T  A         p.3460

           | 67        .         .         .         .         .    g.466812
 GACTTCCAG | GTGAGGGACTCTGCCCAGTCCTTCTTGACAGTGCACGTGCCTCTATATGTG    c.10440
 D  F  Q   | V  R  D  S  A  Q  S  F  L  T  V  H  V  P  L  Y  V      p.3480

          .         .         .         .         .         .       g.466872
 TCCTACATCTATGTGACAGCCCCCAGGGGCTGGGCCTCCTTGGAGCACCACACCGAGATG       c.10500
 S  Y  I  Y  V  T  A  P  R  G  W  A  S  L  E  H  H  T  E  M         p.3500

          .         .         .         . | 68       .         .    g.468973
 GAGTTTTCTTTCTTCTATGACACTGTTCTCTGGAGAACAG | GAATCCAGACAGACAGCGTG    c.10560
 E  F  S  F  F  Y  D  T  V  L  W  R  T  G |   I  Q  T  D  S  V      p.3520

          .         .         .         .         .         .       g.469033
 CTCTCTGCAAGGCTTCAGATAATAAGAATCTACATTCGAGAGGATGGCCGTCTTGTCATT       c.10620
 L  S  A  R  L  Q  I  I  R  I  Y  I  R  E  D  G  R  L  V  I         p.3540

          .         .         | 69         .         .         .    g.470111
 GAATTCAAGACCCATGCCAAATTCAGAG | GACAGTTTGTGATGGAGCATCACACTCTCCCA    c.10680
 E  F  K  T  H  A  K  F  R  G |   Q  F  V  M  E  H  H  T  L  P      p.3560

          .         .         .         .         .         .       g.470171
 GAAGTGAAATCTTTCGTATTGACTCCAGACCACCTAGGAGGAATTGAATTTGACTTGCAG       c.10740
 E  V  K  S  F  V  L  T  P  D  H  L  G  G  I  E  F  D  L  Q         p.3580

          .         .         .         .         .         .       g.470231
 CTATTATGGAGCGCTCAGACTTTTGATTCTCCACATCAACTCTGGAGAGCCACAAGCTCT       c.10800
 L  L  W  S  A  Q  T  F  D  S  P  H  Q  L  W  R  A  T  S  S         p.3600

          | 70         .         .         .         .         .    g.474023
 TATAACAG | GAAGGACTACTCAGGAGAGTACACCATCTACCTGATCCCTTGCACAGTGCAG    c.10860
 Y  N  R  |  K  D  Y  S  G  E  Y  T  I  Y  L  I  P  C  T  V  Q      p.3620

          .         .         .         .         .         .       g.474083
 CCCACACAGCCATGGGTTGACCCAGGAGAGAAGCCTTTGGCCTGCACTGCACATGCCCCA       c.10920
 P  T  Q  P  W  V  D  P  G  E  K  P  L  A  C  T  A  H  A  P         p.3640

       | 71  .         .         .         .         .         .    g.481934
 GAAAG | ATTCCTGATACCCATTGCATTCCAGCAGACCAACCGCCCTGTGCCAGTTGTGTAT    c.10980
 E  R  |  F  L  I  P  I  A  F  Q  Q  T  N  R  P  V  P  V  V  Y      p.3660

          .         .         .         .         .         .       g.481994
 TCACTTAACACTGAATTTCAGCTCTGCAATAATGAGAAGGTGTTCCTAATGGATCCCAAT       c.11040
 S  L  N  T  E  F  Q  L  C  N  N  E  K  V  F  L  M  D  P  N         p.3680

          .         .         .         .         .   | 72     .    g.484433
 ACATCTGATATGTCACTAGCAGAAATGGATTACAAAGGAGCCTTTTCAAAAG | GTCAAATC    c.11100
 T  S  D  M  S  L  A  E  M  D  Y  K  G  A  F  S  K  G |   Q  I      p.3700

          .         .         .         .         .         .       g.484493
 CTTTATGGCCGAGTACTTTGGAATCCAGAACAAAATCTTAATTCTGCTTACAAACTCCAG       c.11160
 L  Y  G  R  V  L  W  N  P  E  Q  N  L  N  S  A  Y  K  L  Q         p.3720

          .         .         .         .         .         .       g.484553
 CTGGAGAAAGTCTATCTTTGTACGGGCAAGGATGGTTATGTGCCTTTCTTTGATCCCACG       c.11220
 L  E  K  V  Y  L  C  T  G  K  D  G  Y  V  P  F  F  D  P  T         p.3740

          .         .         .         .         .         .       g.484613
 GGGACAATCTACAATGAAGGGCCCCAGTATGGATGCATTCAGCCAAACAAACACCTAAAA       c.11280
 G  T  I  Y  N  E  G  P  Q  Y  G  C  I  Q  P  N  K  H  L  K         p.3760

          .         | 73         .         .         .         .    g.486766
 CACAGATTCCTGCTGTTG | GACCGCAATCAGCCAGAGGTAACTGATAAGTACTTCCATGAT    c.11340
 H  R  F  L  L  L   | D  R  N  Q  P  E  V  T  D  K  Y  F  H  D      p.3780

          .         .         .         .         .         .       g.486826
 GTGCCTTTTGAGGCTCACTTTGCCTCTGAGTTGCCTGATTTCCATGTGGTCAGTAACATG       c.11400
 V  P  F  E  A  H  F  A  S  E  L  P  D  F  H  V  V  S  N  M         p.3800

          .         .         .         .      | 74  .         .    g.487976
 CCAGGTGTGGATGGATTTACTCTAAAAGTAGATGCACTCTATAAG | GTGGAAGCAGGACAC    c.11460
 P  G  V  D  G  F  T  L  K  V  D  A  L  Y  K   | V  E  A  G  H      p.3820

          .         .         .         .         .         .       g.488036
 CAGTGGTATCTCCAGGTCATCTACATCATTGGCCCTGACACCATCTCAGGGCCCCGGGTC       c.11520
 Q  W  Y  L  Q  V  I  Y  I  I  G  P  D  T  I  S  G  P  R  V         p.3840

          .         .         .         .         .         .       g.488096
 CAGCGCTCTCTCACAGCTCCACTCAGACGCAACCGAAGGGACCTGGTAGAGCCCGATGGC       c.11580
 Q  R  S  L  T  A  P  L  R  R  N  R  R  D  L  V  E  P  D  G         p.3860

          .         .         .         .         .         .       g.488156
 CAGCTGATCCTTGATGATTCCCTCATCTATGACAATGAAGGAGACCAAGTCAAGAATGGC       c.11640
 Q  L  I  L  D  D  S  L  I  Y  D  N  E  G  D  Q  V  K  N  G         p.3880

          .         .         .         .         .         .       g.488216
 ACCAATATGAAGTCCCTGAATCTGGAGATGCAAGAGTTGGCGGTAGCTGCGTCCCTGTCA       c.11700
 T  N  M  K  S  L  N  L  E  M  Q  E  L  A  V  A  A  S  L  S         p.3900

          .         .         .         .         .         .       g.488276
 CAGACTGGGGCGTCCATTGGCAGTGCCCTGGCTGCAATCATGCTTCTACTTCTGGTGTTT       c.11760
 Q  T  G  A  S  I  G  S  A  L  A  A  I  M  L  L  L  L  V  F         p.3920

          .         .         .         .         .         .       g.488336
 TTGGTGGCTTGTTTTATCAACAGGAAATGCCAGAAACAGAGGAAGAAGAAGCCCGCAGAG       c.11820
 L  V  A  C  F  I  N  R  K  C  Q  K  Q  R  K  K  K  P  A  E         p.3940

          .         .         .         .         .         .       g.488396
 GACATTTTGGAAGAATATCCTCTGAATACCAAGGTAGAAGTGCCCAAGAGGCACCCGGAC       c.11880
 D  I  L  E  E  Y  P  L  N  T  K  V  E  V  P  K  R  H  P  D         p.3960

          .         .         .         .         .         .       g.488456
 CGGGTGGAGAAGAACGTGAATAGACACTACTGCACTGTGCGGAACGTCAACATCCTGAGT       c.11940
 R  V  E  K  N  V  N  R  H  Y  C  T  V  R  N  V  N  I  L  S         p.3980

          .         .         .         .         .         .       g.488516
 GAGCCTGAGGCGGCTTACACGTTCAAAGGTGCTAAAGTCAAAAGACTGAATCTAGAAGTC       c.12000
 E  P  E  A  A  Y  T  F  K  G  A  K  V  K  R  L  N  L  E  V         p.4000

          .         .         .                                     g.488555
 AGAGTTCACAACAATTTACAAGATGGAACAGAAGTTTAA                            c.12039
 R  V  H  N  N  L  Q  D  G  T  E  V  X                              p.4012

          .         .         .         .         .         .       g.488615
 tggaggagacctatgtgtatttttttctaaaatcatttttataaaatggggggaaatact       c.*60

          .         .         .         .         .         .       g.488675
 ggtatttttataatctcgcagataaaaaagggaaaactatagctttgagtggcagacagc       c.*120

          .         .         .         .         .         .       g.488735
 acacatcacatgcatcaactcacaactgagctacctcattcagcaaagaaccactgagaa       c.*180

          .         .         .         .         .         .       g.488795
 ccccagagtattacagttatttccgtagatccctttaatagtgtcaacaactgtacacag       c.*240

          .         .         .         .         .         .       g.488855
 ctccttctgtaaggctggtcttagaaaacaagtactttagtatcaggacaggagttgaac       c.*300

          .         .         .         .         .         .       g.488915
 aattaggttagcagatggagatgagaggactgggtagagtaccatggcagatctcagaga       c.*360

          .         .         .         .         .         .       g.488975
 gaagaagtaggtacgggcctttggttccctcccccagccccagctttctcctacagggct       c.*420

          .         .         .         .         .         .       g.489035
 tttcctgagtccccagacagcagagtatgaactgctgacacccagattccattaaaaatt       c.*480

          .         .         .         .         .         .       g.489095
 ctgctaatcgacacaacacatatatttgctcatgatttcacttgacagcgtatgctcctt       c.*540

          .         .         .         .         .         .       g.489155
 ggcctctaattgtactttgcttttccagagccctttttacctggggatttcagtgtgctt       c.*600

          .         .         .         .         .         .       g.489215
 aagtaaaatcctctgaaaaccacgggagcctctgcctcctcagccacagagaactccctc       c.*660

          .         .         .         .         .         .       g.489275
 ctacaaagggggagactgaaacccgagttaaggaggggcctggcaggcgtatcagagcac       c.*720

          .         .         .         .         .         .       g.489335
 attagtgatgcccttcaccccagggaggtgtctgttcccaactagtttatgtggcactga       c.*780

          .         .         .         .         .         .       g.489395
 gacatccatccctgaccaaggatgctgcgaaacaggatcaatgtactacggccttttaat       c.*840

          .         .         .         .         .         .       g.489455
 tcaacattgccataaatgctttaaagaaaacccaccacactttcctcctactccggtctt       c.*900

          .         .         .         .         .         .       g.489515
 tgcccgttcctgtaacagacaatcccatgtcctaggtatggttttttattctgttagtgc       c.*960

          .         .         .         .         .         .       g.489575
 ttcgggaaagtaagtgattcatttgaataaggcaaattaggagaaagcccaggttggggt       c.*1020

          .         .         .         .         .         .       g.489635
 gaaatcagacttaacagatacatgctggttctccttgctgtgtgtgacacagcagacaga       c.*1080

          .         .         .         .         .         .       g.489695
 ggcactattcctggtgcagtatttcagggatttctctttgaggggttcttttctggtagc       c.*1140

          .         .         .         .         .         .       g.489755
 tcaggcaattatttttaccatatcagcacatgacaaggccatgaacacatggctctaaaa       c.*1200

          .         .         .         .         .         .       g.489815
 taatttagtgttcaagtatcagcttaactattttgtgtaggctacacacagcttgctttt       c.*1260

          .         .         .         .         .         .       g.489875
 gtttctcttctgtttctgccttattggcggaaacataagcgtgcatgccatgttgttttg       c.*1320

          .         .         .         .         .         .       g.489935
 aattggaggcacaatttcattattcgagagtaaaagacatgtcctcttctgatgcatggc       c.*1380

          .         .         .         .         .         .       g.489995
 acaccatagtcaccaagcaaataacagagccttcacattgtgtaatatttgtatgagaat       c.*1440

          .         .         .         .         .         .       g.490055
 gactcaagctctttgagaacattccaaactagtaacatttcgctactaaaagctagaaag       c.*1500

          .         .         .         .         .         .       g.490115
 gatgaactgtgaaaggttctaggcagctctgtgagactccaagctccttgaaagtaggac       c.*1560

          .         .         .         .         .         .       g.490175
 ctttgtgagccacgcctttcattcttcaacagtgccttgcatgtaacaagcactccagaa       c.*1620

          .         .         .         .         .         .       g.490235
 atgtttgttgaatgaatgaatggtgtcatgggtgaatgatggggagtaaatttaggaagg       c.*1680

          .         .         .         .         .         .       g.490295
 ggaagtgagagagtatggtggcaatatcacaagggaggagagaggaaaacaattatcttc       c.*1740

          .         .         .         .         .         .       g.490355
 tctacttggattatgagataaccttttcttggaggaaagaaacaccgctttacaaaggca       c.*1800

          .         .         .         .         .         .       g.490415
 tgactctggcggtggtcctaaggaagcatgagcagaaaattcataaaaatgtatcatcag       c.*1860

          .         .         .         .         .         .       g.490475
 caggagatgagactatgaattggcatccagaacaggagatttagagcaaaatctaattta       c.*1920

          .         .         .         .         .         .       g.490535
 gcattctgagatgagtgtcaggttttcaggagagaatgagttggggtgagcccagagtct       c.*1980

          .         .         .         .         .         .       g.490595
 gaaactcctgactggtcaggtgctacttaagaccagcttgggcaattcagggcagaactc       c.*2040

          .         .         .         .         .         .       g.490655
 ctgtatcagcctcatggacacccagaattggtatctcatggctggagagctgatcagcca       c.*2100

          .         .         .         .         .         .       g.490715
 ggcacagaatctccagaacaacctagagagtgaatgctaatttgtagagcgaacttccat       c.*2160

          .         .         .         .         .         .       g.490775
 ttggcccattatttgtaactgtgtaactgctccaagtgccagaatgcttacacgttaaag       c.*2220

          .         .         .         .         .         .       g.490835
 cagcacctttccatttgcccacatattcttcttgcacaccccttccattactgctgaata       c.*2280

          .         .         .         .         .         .       g.490895
 ggacattgcatgggaagagtacagaggtggcagaatgaagctagagtgggaaggactaaa       c.*2340

          .         .         .         .         .         .       g.490955
 gactgagccccagagtgctcccagcaaccgccacgtacaaggtctgaaatgacaagggca       c.*2400

          .         .         .         .         .         .       g.491015
 agagtgagataggaaactgtgtgtgaaaggaaagcccttgcagtatttctgcctcccttt       c.*2460

          .         .         .         .         .         .       g.491075
 ctttctgcctttcaccccactaaatgtatgttattgaatgccagtacttctctagtggat       c.*2520

          .         .         .         .         .         .       g.491135
 gcacacttgttaaatagtgttaagagatgtggagatgagatatacccctttgatgtagaa       c.*2580

          .         .         .         .         .         .       g.491195
 ttattcatttggtttgtttcatacttcattataggaatcaagtaatttgatgactaatgt       c.*2640

          .         .         .         .         .         .       g.491255
 ggattatatttcagtcaaagctctgctttcaatttctctgatttgctcactaatgccttg       c.*2700

          .         .         .         .         .         .       g.491315
 tgtgtgttttactaaccttttatatcttgccttcaagtgagaaggaacaaacaactctca       c.*2760

          .         .         .         .         .         .       g.491375
 gtggttactacttgcttttatatgctggctgtgaaggttaaaagaaagaatggtctgtac       c.*2820

          .         .         .         .         .         .       g.491435
 cattctgctttgctgcccttttattgtaccccaggcctcctagaggactcctgcagattc       c.*2880

          .         .         .         .         .         .       g.491495
 tattgttgggtgggaaatagtgttggaatgtgtttgcacagtcttatgatattcagtctc       c.*2940

          .         .         .         .         .         .       g.491555
 agtctgctataggtatttgttattcttggatactacacacctgctcagactgagtaaaca       c.*3000

          .         .         .         .         .         .       g.491615
 tttgtggtgctgtcaacctgatttcttgactctcaaatgatttttgtatttccaatatga       c.*3060

          .         .         .         .         .         .       g.491675
 atttgtgtgttatgaatttctgatttctccaatagtatatgccactatataaatttgtat       c.*3120

          .         .                                               g.491700
 taataaatgacagtcttgttggttt                                          c.*3145

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Fraser extracellular matrix complex subunit 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 35
©2004-2018 Leiden University Medical Center