FRAS1 related extracellular matrix 1 (FREM1) - coding DNA reference sequence

(used for mutation description)

(last modified May 2, 2018)


This file was created to facilitate the description of sequence variants in the FREM1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from VERSION NG_017005.2, covering FREM1 transcript NM_144966.5.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.4277
                         acacaaaaagccttacaaatggaagaactaaggtgg       c.-781

 .         .         .         .         .         .                g.4337
 tacttaaaaacagcaccttaggatctagttccatcctatcttttcccttaaatgccatga       c.-721

 .         .         .         .         .         .                g.4397
 caaaagttaaaacgggccctgtcccttctgaatgctgggcttctcatctaaatttaaata       c.-661

 .         .         .         .         .         .                g.4457
 aaaacctttgaagatgggaatgtgttggaagaaaagaagggcagaaaaaaagtgtgttgg       c.-601

 .          | 02        .         .         .         .             g.5050
 aagagtctgt | ggagtcctgaggcttggcgctcaggaagtttgcaaagctgcagcagctgc    c.-541

 .         .         .         .         .         .                g.5110
 cttggagaagaccagcaaagaaagtggagtgtgtatgtgaacttcaattctgtattttct       c.-481

 .         .         .         .         .         .                g.5170
 gtgaggtgggttaatggatttttagtaaaaagaaatctcaaacacagctgacctgaaaga       c.-421

 .         .         .         .         .         .                g.5230
 ctggaatttcagctctcttccttcccggggttctttttcctcccccttcctctcaaagcc       c.-361

 .         .         .         .         .         .                g.5290
 ctttaaaccagattgctgtgtcagtgactcttatcctgcccgccagttccaagggtttct       c.-301

 .         .         .         .   | 03     .         .             g.46019
 aactttttgtcttggaaaggaaaaccactacct | gattagaaaagcacttgggaagcccat    c.-241

 .         .         .         .         .         .                g.46079
 taatcttgccggcgttgtcaggagtgatcagcgagttttattaaaagccctgggattgcc       c.-181

 .         .         .         .         .         .                g.46139
 tgaaaggcccccttgtctgactttgaaatgaaaggggcatgttaagatctcggggcacat       c.-121

 .         .         .         .         .         .                g.46199
 tgtcaggacccctcaccctgccccttggactatgagctgaccctccaggaggaagcacag       c.-61

 .         .         .         .         .         .                g.46259
 aagccctcctttgttaaagggatttcgccggtggacagagaagagttgggccctgtcagc       c.-1

          .         .         .         .         .         .       g.46319
 ATGAACTCTCTGAGTTGGGGGGCTGCGAATGCCGTGCTGCTGCTGCTCCTCCTGGCCTGG       c.60
 M  N  S  L  S  W  G  A  A  N  A  V  L  L  L  L  L  L  A  W         p.20

          .         .         .         .         .         .       g.46379
 GCCAGCCCCACCTTCATCAGCATCAACCGCGGGGTGAGGGTGATGAAGGGCCACTCTGCC       c.120
 A  S  P  T  F  I  S  I  N  R  G  V  R  V  M  K  G  H  S  A         p.40

          .         .         .         .         .         .       g.46439
 TTCCTGTCAGGAGATGACCTGAAGTTTGCCATCCCTAAAGAGAAAGATGCCTGCAAAGTG       c.180
 F  L  S  G  D  D  L  K  F  A  I  P  K  E  K  D  A  C  K  V         p.60

          .         .         .         .         .     | 04   .    g.51339
 GAAGTTGTGATGAATGAGCCAATAACCCAGAGGGTTGGGAAACTCACTCCACAG | GTCTTT    c.240
 E  V  V  M  N  E  P  I  T  Q  R  V  G  K  L  T  P  Q   | V  F      p.80

          .         .         .         .         .         .       g.51399
 GACTGCCATTTCCTTCCCAACGAAGTCAAGTATGTTCACAATGGTTGTCCAATTCTTGAT       c.300
 D  C  H  F  L  P  N  E  V  K  Y  V  H  N  G  C  P  I  L  D         p.100

          .         .          | 05        .         .         .    g.55783
 GAAGACACAGTGAAGCTCAGACTTTACAG | ATTTACTGAAAGAGATACCTTCATAGAAACT    c.360
 E  D  T  V  K  L  R  L  Y  R  |  F  T  E  R  D  T  F  I  E  T      p.120

          .         .         .         .         .         .       g.55843
 TTTATCCTGTGGGTCTATCTCCTGGAACCAGACTGTAACATCATCCATATGAGTAACAAT       c.420
 F  I  L  W  V  Y  L  L  E  P  D  C  N  I  I  H  M  S  N  N         p.140

          .         .         .         .         .         .       g.55903
 GTGCTGGAGGTGCCTGAATTCAATGGCTTGTCCCAAGCGATTGATAAAAATCTGCTCAGA       c.480
 V  L  E  V  P  E  F  N  G  L  S  Q  A  I  D  K  N  L  L  R         p.160

          .         .         .         .         .         .       g.55963
 TTCGATTATGATAGGATGGCTAGCCTGGAATGTACCGTCAGCCTGGACACTGCGAGAACT       c.540
 F  D  Y  D  R  M  A  S  L  E  C  T  V  S  L  D  T  A  R  T         p.180

          .         .         .         .         .         .       g.56023
 CGGCTGCCAGCCCATGGCCAGATGGTTCTCGGGGAGCCTCGACCAGAAGAACCTCGTGGA       c.600
 R  L  P  A  H  G  Q  M  V  L  G  E  P  R  P  E  E  P  R  G         p.200

          .         .         .  | 06      .         .         .    g.57516
 GATCAGCCACACAGTTTTTTCCCAGAGTCCC | AACTGAGAGCAAAACTGAAGTGTCCAGGT    c.660
 D  Q  P  H  S  F  F  P  E  S  Q |   L  R  A  K  L  K  C  P  G      p.220

          .         .         .         .         .         .       g.57576
 GGGAGCTGTACCCCAGGATTAAAGAAAATAGGAAGCCTCAAAGTGAGCTGTGAGGAGTTC       c.720
 G  S  C  T  P  G  L  K  K  I  G  S  L  K  V  S  C  E  E  F         p.240

          .         .         .         .         .         .       g.57636
 CTGCTGATGGGCCTTCGTTATCAGCATCTGGATCCCCCTTCACCCAACATTGATTATATC       c.780
 L  L  M  G  L  R  Y  Q  H  L  D  P  P  S  P  N  I  D  Y  I         p.260

          .         .         .         .         | 07         .    g.63641
 TCCATCCAACTGGACCTCACAGATACCAGGAGCAAAATTGTGTACAAG | TCAGAGAGTGCG    c.840
 S  I  Q  L  D  L  T  D  T  R  S  K  I  V  Y  K   | S  E  S  A      p.280

          .         .         .         .         .         .       g.63701
 TGGCTGCCTGTCTATATCAGAGCTGGAATTCCGAATCAGATTCCAAAGGCTGCATTCATG       c.900
 W  L  P  V  Y  I  R  A  G  I  P  N  Q  I  P  K  A  A  F  M         p.300

          .         .         .         .         .         .       g.63761
 GCCGTGTTTATTCTGGAAGTGGATCAGTTCATCCTGACCTCCTTGACTACATCAGTTCTG       c.960
 A  V  F  I  L  E  V  D  Q  F  I  L  T  S  L  T  T  S  V  L         p.320

          .         .         .         .         .         .       g.63821
 GACTGTGAAGAAGATGAGACCCCTAAACCCTTGCTGGTGTTCAACATTACTAAAGCCCCG       c.1020
 D  C  E  E  D  E  T  P  K  P  L  L  V  F  N  I  T  K  A  P         p.340

          .         .         .         .         .         .       g.63881
 CTCCAGGGCTATGTGACTCACCTGTTGGATCACACCAGACCAATCTCCTCATTCACCTGG       c.1080
 L  Q  G  Y  V  T  H  L  L  D  H  T  R  P  I  S  S  F  T  W         p.360

          .         .         .         .         .         .       g.63941
 AAAGATCTCAGTGACATGCAGATCGCCTATCAGCCACCAAACAGCAGCCATTCTGAGAGG       c.1140
 K  D  L  S  D  M  Q  I  A  Y  Q  P  P  N  S  S  H  S  E  R         p.380

          .   | 08     .         .         .         .         .    g.66511
 AGACATGATGAG | GTAGAATTGGAGGTATACGACTTCTTCTTTGAAAGGAGTGCACCTATG    c.1200
 R  H  D  E   | V  E  L  E  V  Y  D  F  F  F  E  R  S  A  P  M      p.400

          .         .         .         .         .         .       g.66571
 ACAGTCCACATCTCCATCAGAACAGCAGATACAAATGCCCCCCGTGTATCCTGGAATACA       c.1260
 T  V  H  I  S  I  R  T  A  D  T  N  A  P  R  V  S  W  N  T         p.420

   | 09      .         .         .         .         .         .    g.69204
 G | GTCTGAGTCTCCTTGAGGGGCAGTCTCGAGCCATCACTTGGGAACAGTTTCAGGTTGTC    c.1320
 G |   L  S  L  L  E  G  Q  S  R  A  I  T  W  E  Q  F  Q  V  V      p.440

          .         .         .         .         .         .       g.69264
 GACAATGACGACATTGGTGCTGTCCGGCTAGTCACCGTTGGTGGCCTGCAGCATGGATGG       c.1380
 D  N  D  D  I  G  A  V  R  L  V  T  V  G  G  L  Q  H  G  W         p.460

          .    | 10    .         .         .         .         .    g.72623
 CTGACTTTAAGAG | GGGGGAAAGGGTTTCTCTTCACCGTGGCTGACCTCCAGGCTGGAGTT    c.1440
 L  T  L  R  G |   G  K  G  F  L  F  T  V  A  D  L  Q  A  G  V      p.480

          .         .         .         .         .         .       g.72683
 GTTCGCTATCATCATGATGACAGCGACTCCACCAAAGACTTCGTGGTCTTCCGGATATTT       c.1500
 V  R  Y  H  H  D  D  S  D  S  T  K  D  F  V  V  F  R  I  F         p.500

          .         .         .         .         .         .       g.72743
 GATGGCCATCACAGCATCCGTCACAAATTCCCCATCAACGTCTTGCCCAAAGATGATAGT       c.1560
 D  G  H  H  S  I  R  H  K  F  P  I  N  V  L  P  K  D  D  S         p.520

          .         .         .         .         .         .       g.72803
 CCCCCGTTCCTCATAACCAATGTTGTGATTGAACTGGAGGAGGGGCAGACCATCCTGATC       c.1620
 P  P  F  L  I  T  N  V  V  I  E  L  E  E  G  Q  T  I  L  I         p.540

          .         .         .         .         .         .       g.72863
 CAGGGATCCATGCTGCGAGCTTCAGATGTGGACGCCAGTGATGACTACATCTTCTTCAAT       c.1680
 Q  G  S  M  L  R  A  S  D  V  D  A  S  D  D  Y  I  F  F  N         p.560

          .         .         .         .         .         | 11    g.73649
 ATCACAAAGCCTCCACAGGCTGGGGAGATCATGAAGAAGCCAGGGCCAGGACTGATAG | GC    c.1740
 I  T  K  P  P  Q  A  G  E  I  M  K  K  P  G  P  G  L  I  G |       p.580

          .         .         .         .         .         .       g.73709
 TATCCTGTCCATGGCTTCCTTCAGAGGGATTTGTTTAATGGAATCATTTATTATCGTCAT       c.1800
 Y  P  V  H  G  F  L  Q  R  D  L  F  N  G  I  I  Y  Y  R  H         p.600

          .         .         .         .         .         .       g.73769
 TTTGGTGGAGAAATCTTTGAAGATTCTTTTCAATTTGTCCTGTGGGACAGCCATGAACCT       c.1860
 F  G  G  E  I  F  E  D  S  F  Q  F  V  L  W  D  S  H  E  P         p.620

          .         .  | 12      .         .         .         .    g.90283
 CCAAATCTTTCAGTGCCACAG | GTGGCAACAATCCATATAACTCCAGTGGATGACCAGCTT    c.1920
 P  N  L  S  V  P  Q   | V  A  T  I  H  I  T  P  V  D  D  Q  L      p.640

          .         .         .         .         .         .       g.90343
 CCAAAAGAGGCTCCTGGAGTTTCTCGGCATTTGGTTGTCAAGGAAACTGAGGTGGCCTAT       c.1980
 P  K  E  A  P  G  V  S  R  H  L  V  V  K  E  T  E  V  A  Y         p.660

          .         .         .         .         .         .       g.90403
 ATAACTAAGAAACAGCTACATTTTATAGATTCAGAATCATATGACAGGGAGCTGGTCTAC       c.2040
 I  T  K  K  Q  L  H  F  I  D  S  E  S  Y  D  R  E  L  V  Y         p.680

          .         .         .         | 13         .         .    g.91143
 ACAATAACTACTCCTCCATTTTTCTCCTTCAGCCACAG | ACACTTGGATGCTGGGAAATTA    c.2100
 T  I  T  T  P  P  F  F  S  F  S  H  R  |  H  L  D  A  G  K  L      p.700

          .         .         .         .         .         .       g.91203
 TTTATGGTGGACAGCATACCAAAAGTAGTTAAGAATCCTACGGCCCTGGAGCTGAGGTCA       c.2160
 F  M  V  D  S  I  P  K  V  V  K  N  P  T  A  L  E  L  R  S         p.720

           | 14        .         .         .         .         .    g.91960
 TTCACTCAG | CATGCTGTGAACTATATGAAAGTGGCCTACATGCCCCCCATGCAAGACATT    c.2220
 F  T  Q   | H  A  V  N  Y  M  K  V  A  Y  M  P  P  M  Q  D  I      p.740

          .         .         .         .         .         .       g.92020
 GGTCCCCATTGCAGAGATGTCCAGTTCACATTTTCTGTCAGTAACCAACATGGCGGTACT       c.2280
 G  P  H  C  R  D  V  Q  F  T  F  S  V  S  N  Q  H  G  G  T         p.760

          .         .         .         .         .        | 15.    g.95797
 TTGCATGGGATCTGCTTTAACATTACAATCCTCCCAGTGGACAATCAAGTTCCTGAG | GCG    c.2340
 L  H  G  I  C  F  N  I  T  I  L  P  V  D  N  Q  V  P  E   | A      p.780

          .         .         .         .         .         .       g.95857
 TTCACCAACCCTCTGAAAGTGACTGAGGGAGGTCAAAGCATCATCAGCACAGAGCACATT       c.2400
 F  T  N  P  L  K  V  T  E  G  G  Q  S  I  I  S  T  E  H  I         p.800

          .         .         .         .         .         .       g.95917
 CTAATTTCTGATGCAGATACCAAGCTGGACAATATTGACCTCTCCCTGCGGGAATTGCCT       c.2460
 L  I  S  D  A  D  T  K  L  D  N  I  D  L  S  L  R  E  L  P         p.820

          .         .         .         .         .         .       g.95977
 CTGCACGGAAGGGTGGAGCTGAATGGATTTCCTCTAAATTCAGGGGGCACATTTTCTTGG       c.2520
 L  H  G  R  V  E  L  N  G  F  P  L  N  S  G  G  T  F  S  W         p.840

          .         .       | 16 .         .         .         .    g.98399
 GGCGATCTCCATACCTTAAAAGTTAG | GTATCAACATGATGGAACTGAAGTTCTTCAGGAT    c.2580
 G  D  L  H  T  L  K  V  R  |  Y  Q  H  D  G  T  E  V  L  Q  D      p.860

          .         .         .         .         .         .       g.98459
 GACCTACTCTTGGAGGTCACCGATGGCACAAATTCAGCAGAATTTGTACTACATGTTGAG       c.2640
 D  L  L  L  E  V  T  D  G  T  N  S  A  E  F  V  L  H  V  E         p.880

  | 17       .         .         .         .         .         .    g.102232
  | GTATTCCCTGTCAACGATGAGCCACCAGTCTTAAAGGCTGACCTCATGCCTGTCATGAAT    c.2700
  | V  F  P  V  N  D  E  P  P  V  L  K  A  D  L  M  P  V  M  N      p.900

          .         .         .         .         .         .       g.102292
 TGCTCAGAGGGAGGAGAGGTGGTCATCACCTCTGAATACATTTTTGCTACTGATGTGGAC       c.2760
 C  S  E  G  G  E  V  V  I  T  S  E  Y  I  F  A  T  D  V  D         p.920

          .         .         .         .         .         .       g.102352
 AGCGATAACTTGAAGTTGATGTTTGTGATTGCTCGCGAACCTCAGCATGGGGTGGTGAGG       c.2820
 S  D  N  L  K  L  M  F  V  I  A  R  E  P  Q  H  G  V  V  R         p.940

          .         .         .         .         .         .       g.102412
 AGAGCTGGAGTCACAGTGGATCAGTTCTCTCAGAGAGATGTTATCTCAGAGGCCGTGACA       c.2880
 R  A  G  V  T  V  D  Q  F  S  Q  R  D  V  I  S  E  A  V  T         p.960

          .    | 18    .         .         .         .         .    g.107149
 TACAAACACACAG | GTGGCGAGATTGGCCTGATGCCTTGTTTTGACACCATTACATTGGTG    c.2940
 Y  K  H  T  G |   G  E  I  G  L  M  P  C  F  D  T  I  T  L  V      p.980

          .         .         .         .         .         .       g.107209
 GTTTCGGATGGAGAGGCTGGCCCTTTTGTGAATGGCTGTTGCTACAATGGACCCAATCCA       c.3000
 V  S  D  G  E  A  G  P  F  V  N  G  C  C  Y  N  G  P  N  P         p.1000

          .         .         .         .         .         .       g.107269
 TCTGTTCCACTTCATGCGTCCTTTCCAGTGTATGATCTCAACATCACGGTATACCCAGTA       c.3060
 S  V  P  L  H  A  S  F  P  V  Y  D  L  N  I  T  V  Y  P  V         p.1020

          .         .         | 19         .         .         .    g.108422
 GACAACCAGCCACCTTCCATTGCAATAG | GTCCCGTGTTTGTTGTAGATGAGGGCTGCTCA    c.3120
 D  N  Q  P  P  S  I  A  I  G |   P  V  F  V  V  D  E  G  C  S      p.1040

          .         .         .         .         .         .       g.108482
 ACAGCCCTTACTGTTAACCATTTGTCCGCCACTGACCCTGACACTGCAGCAGATGACTTG       c.3180
 T  A  L  T  V  N  H  L  S  A  T  D  P  D  T  A  A  D  D  L         p.1060

          .         .         .         .         .         .       g.108542
 GAATTTGTTTTGGTTTCTCCTCCTCAGTTTGGCTACCTCGAAAATATACTCCCTTCTGTG       c.3240
 E  F  V  L  V  S  P  P  Q  F  G  Y  L  E  N  I  L  P  S  V         p.1080

          .         .         .     | 20   .         .         .    g.110110
 GGTTTTGAAAAAAGCAATATTGGCATAAGTATAG | ATTCATTTCAGTGGAAAGACATGAAC    c.3300
 G  F  E  K  S  N  I  G  I  S  I  D |   S  F  Q  W  K  D  M  N      p.1100

          .         .         .         .         .         .       g.110170
 GCTTTTCACATTAACTATGTGCAGTCCAGGCATCTGAGGATAGAACCAACTGCCGACCAG       c.3360
 A  F  H  I  N  Y  V  Q  S  R  H  L  R  I  E  P  T  A  D  Q         p.1120

          .         .         .         .         .         .       g.110230
 TTCACGGTGTACGTCACAGATGGGAAGCATCACTCCTTGGAGATACCATTTTCTATTATA       c.3420
 F  T  V  Y  V  T  D  G  K  H  H  S  L  E  I  P  F  S  I  I         p.1140

          .         .         .         .         .  | 21      .    g.113371
 ATCAACCCCACAAATGATGAAGCTCCTGACTTTGTAGTGCAGAATATTACT | GTGTGTGAG    c.3480
 I  N  P  T  N  D  E  A  P  D  F  V  V  Q  N  I  T   | V  C  E      p.1160

          .         .         .         .         .         .       g.113431
 GGTCAGATGAAAGAGCTGGACTCTTCCATCATCAGCGCTGTGGACCTGGACATTCCCCAG       c.3540
 G  Q  M  K  E  L  D  S  S  I  I  S  A  V  D  L  D  I  P  Q         p.1180

          .         .         .         .         .         .       g.113491
 GATGCCCTGCTGTTCAGCATCACTCAAAAGCCACGCCATGGCCTCCTCATCGATAGGGGG       c.3600
 D  A  L  L  F  S  I  T  Q  K  P  R  H  G  L  L  I  D  R  G         p.1200

          .         .         .         .         .         .       g.113551
 TTTAGCAAAGACTTCTCTGAGAATAAGCAGCCAGCCAACCCTCACCAGAAACATGCACCT       c.3660
 F  S  K  D  F  S  E  N  K  Q  P  A  N  P  H  Q  K  H  A  P         p.1220

          .         .         .     | 22   .         .         .    g.117620
 GTTCACAGCTTTTCCATGGAACTCCTCAAGACTG | GAATGAGGTTGACGTACATGCATGAT    c.3720
 V  H  S  F  S  M  E  L  L  K  T  G |   M  R  L  T  Y  M  H  D      p.1240

          .         .         .         .         .         .       g.117680
 GACTCAGAGAGCCTTGCTGATGATTTTACAATCCAATTGTCAGATGGGAAACATAAGATA       c.3780
 D  S  E  S  L  A  D  D  F  T  I  Q  L  S  D  G  K  H  K  I         p.1260

          .         .         .         .         .          | 23    g.122353
 CTTAAAACCATTTCAGTAGAGGTCATCCCAGTTAATGATGAAAAACCAATGCTGAGCAA | G    c.3840
 L  K  T  I  S  V  E  V  I  P  V  N  D  E  K  P  M  L  S  K  |      p.1280

          .         .         .         .         .         .       g.122413
 AAGGCTGAAATTGCAATGAATATGGGTGAAACTCGTATTATTTCCAGTGCTATTCTTTCA       c.3900
 K  A  E  I  A  M  N  M  G  E  T  R  I  I  S  S  A  I  L  S         p.1300

          .         .         .         .         .         .       g.122473
 GCCATAGATGAAGACTCACCCAGGGAGAAGATTTACTATGTATTTGAAAGGCTTCCCCAA       c.3960
 A  I  D  E  D  S  P  R  E  K  I  Y  Y  V  F  E  R  L  P  Q         p.1320

          .         .  | 24      .         .         .         .    g.126161
 AATGGGCAACTTCAGCTTAAG | ATAGGGAGGGACTGGGTTCCTCTCTCCCCTGGCATGAAA    c.4020
 N  G  Q  L  Q  L  K   | I  G  R  D  W  V  P  L  S  P  G  M  K      p.1340

          .         .         .         .         .         .       g.126221
 TGCACTCAGGAGGAAGTGGATCTGAACTTGCTGAGATACACACACACCGGGGCAATGGAT       c.4080
 C  T  Q  E  E  V  D  L  N  L  L  R  Y  T  H  T  G  A  M  D         p.1360

          .         .         .         .         .         .       g.126281
 TCCCAGAATCAAGATAGCTTCACCTTCTACCTTTGGGATGGCAACAACAGGTCCCCTGCT       c.4140
 S  Q  N  Q  D  S  F  T  F  Y  L  W  D  G  N  N  R  S  P  A         p.1380

          .         .         .        | 25.         .         .    g.130625
 CTTGACTGTCAAATCACCATCAAGGACATGGAAAAAG | GTGATATTGTCATCCTTACAAAA    c.4200
 L  D  C  Q  I  T  I  K  D  M  E  K  G |   D  I  V  I  L  T  K      p.1400

          .         .         .         .         .         .       g.130685
 CCACTCGTGGTGTCTAAAGGTGATAGAGGTTTCTTAACAACCACCACGCTCCTGGCTGTG       c.4260
 P  L  V  V  S  K  G  D  R  G  F  L  T  T  T  T  L  L  A  V         p.1420

          .         .         .         .         .         .       g.130745
 GACGGAACAGACAAGCCTGAGGAACTGCTCTATGTCATCACCTCCCCTCCGCGATATGGC       c.4320
 D  G  T  D  K  P  E  E  L  L  Y  V  I  T  S  P  P  R  Y  G         p.1440

          .         .         .         .         .         .       g.130805
 CAGATCGAATATGTTCACTATCCTGGAGTTCCCATTACAAACTTCAGCCAAATGGATGTA       c.4380
 Q  I  E  Y  V  H  Y  P  G  V  P  I  T  N  F  S  Q  M  D  V         p.1460

          .         .         .         .         .         .       g.130865
 GTGGGGCAGACAGTTTGCTATGTACACAAGAGCAAGGTGACTGTCTCCAGTGACAGATTC       c.4440
 V  G  Q  T  V  C  Y  V  H  K  S  K  V  T  V  S  S  D  R  F         p.1480

    | 26     .         .         .         .         .         .    g.139091
 AG | ATTCATCATCAGCAATGGACTGCGGACCGAGCACGGGGTGTTTGAGATCACACTGGAG    c.4500
 R  |  F  I  I  S  N  G  L  R  T  E  H  G  V  F  E  I  T  L  E      p.1500

          .         .         .         .         .         .       g.139151
 ACTGTGGACAGAGCCCTGCCTGTGGTAACCAGGAACAAGGGGTTGAGACTGGCCCAAGGG       c.4560
 T  V  D  R  A  L  P  V  V  T  R  N  K  G  L  R  L  A  Q  G         p.1520

          .         .         .         .         .         .       g.139211
 GCCGTGGGCCTGCTTTCCCCTGACCTCCTTCAGCTGACCGACCCTGATACACCTGCGGAG       c.4620
 A  V  G  L  L  S  P  D  L  L  Q  L  T  D  P  D  T  P  A  E         p.1540

          .         .         .         .         .         .       g.139271
 AACCTCACCTTCCTCTTGGTTCAGCTCCCCCAGCATGGCCAGCTCTACCTGTGGGGGACA       c.4680
 N  L  T  F  L  L  V  Q  L  P  Q  H  G  Q  L  Y  L  W  G  T         p.1560

          .         .         .         .         .         .       g.139331
 GGGCTACTTCAACACAATTTCACCCAGCAGGATGTGGACAGCAAGAATGTGGCCTATCGG       c.4740
 G  L  L  Q  H  N  F  T  Q  Q  D  V  D  S  K  N  V  A  Y  R         p.1580

          .         .         .         .         .         .       g.139391
 CACTCAGGAGGGGACTCCCAGACTGACTGCTTTACTTTCATGGCCACAGATGGGACAAAC       c.4800
 H  S  G  G  D  S  Q  T  D  C  F  T  F  M  A  T  D  G  T  N         p.1600

          .         .         .         .         .        | 27.    g.144433
 CAAGGCTTTATTGTGAATGGGAGAGTGTGGGAAGAACCTGTTTTATTCACCATTCAG | GTA    c.4860
 Q  G  F  I  V  N  G  R  V  W  E  E  P  V  L  F  T  I  Q   | V      p.1620

          .         .         .         .         .         .       g.144493
 GACCAATTGGACAAAACAGCTCCTCGTATCACACTCTTGCATTCCCCTTCTCAAGTGGGG       c.4920
 D  Q  L  D  K  T  A  P  R  I  T  L  L  H  S  P  S  Q  V  G         p.1640

          .         .         .         .         .         .       g.144553
 CTCCTGAAAAATGGCTGCTACGGGATTTACATCACTTCCCGCGTGTTGAAGGCATCAGAC       c.4980
 L  L  K  N  G  C  Y  G  I  Y  I  T  S  R  V  L  K  A  S  D         p.1660

          .         .         .         .         .         .       g.144613
 CCTGACACTGAGGACGATCAGATCATCTTTAAAATTCTACAAGGCCCAAAACATGGACAT       c.5040
 P  D  T  E  D  D  Q  I  I  F  K  I  L  Q  G  P  K  H  G  H         p.1680

          .          | 28        .         .         .         .    g.145409
 CTGGAGAACACAACAACAG | GTGAATTTATCCATGAGAAATTTAGCCAAAAGGACTTAAAC    c.5100
 L  E  N  T  T  T  G |   E  F  I  H  E  K  F  S  Q  K  D  L  N      p.1700

          .         .         .         .         .         .       g.145469
 AGTAAGACTATTCTTTACATCATAAACCCATCTTTGGAAGTAAATTCAGATACCGTGGAA       c.5160
 S  K  T  I  L  Y  I  I  N  P  S  L  E  V  N  S  D  T  V  E         p.1720

          .         .         .         .     | 29   .         .    g.155351
 TTTCAAATCATGGACCCCACAGGGAACTCGGCCACTCCTCAAAT | TTTGGAACTGAAGTGG    c.5220
 F  Q  I  M  D  P  T  G  N  S  A  T  P  Q  I  |  L  E  L  K  W      p.1740

          .         .         .         .         .         .       g.155411
 TCTCATATTGAATGGTCACAGACCGAATATGAAGTCTGTGAGAATGTGGGTTTGTTGCCC       c.5280
 S  H  I  E  W  S  Q  T  E  Y  E  V  C  E  N  V  G  L  L  P         p.1760

          .         .         .         .         .     | 30   .    g.158796
 TTGGAAATTATCAGAAGGGGATATTCCATGGACTCGGCCTTTGTGGGTATAAAG | GTCAAC    c.5340
 L  E  I  I  R  R  G  Y  S  M  D  S  A  F  V  G  I  K   | V  N      p.1780

          .         .         .         .         .         .       g.158856
 CAAGTGTCAGCTGCAGTTGGAAAAGATTTCACCGTGATTCCATCTAAACTGATTCAGTTT       c.5400
 Q  V  S  A  A  V  G  K  D  F  T  V  I  P  S  K  L  I  Q  F         p.1800

         | 31.         .         .         .         .         .    g.165013
 GACCCAG | GAATGTCAACTAAGATGTGGAATATAGCAATTACCTATGACGGATTAGAGGAA    c.5460
 D  P  G |   M  S  T  K  M  W  N  I  A  I  T  Y  D  G  L  E  E      p.1820

          .         .         .         .         .         .       g.165073
 GATGATGAGGTCTTTGAAGTAATTCTGAACTCCCCTGTGAATGCAGTTCTTGGCACAAAG       c.5520
 D  D  E  V  F  E  V  I  L  N  S  P  V  N  A  V  L  G  T  K         p.1840

          .         .         .        | 32.         .         .    g.166620
 ACAAAAGCTGCAGTGAAAATTTTGGACTCAAAAGGAG | GACAATGCCATCCTTCATATTCC    c.5580
 T  K  A  A  V  K  I  L  D  S  K  G  G |   Q  C  H  P  S  Y  S      p.1860

          .         .         .         .         .         .       g.166680
 TCCAACCAAAGCAAGCACAGCACATGGGAGAAGGGCATTTGGCATCTGCTGCCCCCAGGG       c.5640
 S  N  Q  S  K  H  S  T  W  E  K  G  I  W  H  L  L  P  P  G         p.1880

          .         .         .         .         .         .       g.166740
 TCTTCCTCATCCACCACTTCTGGTTCCTTTCATCTGGAAAGAAGACCTCTTCCATCTTCC       c.5700
 S  S  S  S  T  T  S  G  S  F  H  L  E  R  R  P  L  P  S  S         p.1900

          .         .         .         .         .         .       g.166800
 ATGCAGCTAGCAGTCATCAGGGGAGACACCCTGCGGGGCTTTGATTCTACAGATCTTTCT       c.5760
 M  Q  L  A  V  I  R  G  D  T  L  R  G  F  D  S  T  D  L  S         p.1920

          .         .         .       | 33 .         .         .    g.167532
 CAAAGGAAGCTTAGGACCCGTGGGAATGGCAAAACA | GTTCGTCCATCCTCTGTTTATAGA    c.5820
 Q  R  K  L  R  T  R  G  N  G  K  T   | V  R  P  S  S  V  Y  R      p.1940

          .         .     | 34   .         .         .         .    g.167844
 AATGGAACAGACATCATCTATAAT | TATCATGGGATAGTTTCCTTGAAACTGGAGGATGAC    c.5880
 N  G  T  D  I  I  Y  N   | Y  H  G  I  V  S  L  K  L  E  D  D      p.1960

          .         .         .         .         .         .       g.167904
 AGTTTCCCAACTCACAAAAGGAAGGCCAAAGTATCCATCATTAGTCAGCCACAAAAGACA       c.5940
 S  F  P  T  H  K  R  K  A  K  V  S  I  I  S  Q  P  Q  K  T         p.1980

          .         .         .         .         .         .       g.167964
 ATCAAAGTGGCAGAACTGCCTCAAGCAGATAAGGTGGAATCCACAACTGACTCACACTTC       c.6000
 I  K  V  A  E  L  P  Q  A  D  K  V  E  S  T  T  D  S  H  F         p.2000

           | 35        .         .         .         .         .    g.168236
 CCCAGACAG | GACCAGTTGCCCTCATTTCCAAAGAACTGCACTCTGGAATTAAAGGGACTC    c.6060
 P  R  Q   | D  Q  L  P  S  F  P  K  N  C  T  L  E  L  K  G  L      p.2020

          .         .         .         .         .         .       g.168296
 TTCCATTTTGAAGAAGGCATCCAGAAGCTGTATCAGTGCAATGGGATCGCCTGGAAAGCC       c.6120
 F  H  F  E  E  G  I  Q  K  L  Y  Q  C  N  G  I  A  W  K  A         p.2040

          .         | 36         .         .         .         .    g.168810
 TGGAGTCCCCAAACCAAG | GATGTGGAAGACAAATCCTGTCCAGCCGGGTGGCACCAGCAC    c.6180
 W  S  P  Q  T  K   | D  V  E  D  K  S  C  P  A  G  W  H  Q  H      p.2060

          .         .         .         .         .         .       g.168870
 TCAGGCTACTGTCACATCTTGATCACAGAGCAGAAAGGCACCTGGAATGCGGCTGCCCAA       c.6240
 S  G  Y  C  H  I  L  I  T  E  Q  K  G  T  W  N  A  A  A  Q         p.2080

          .     | 37   .         .         .         .         .    g.175048
 GCTTGCAGGGAACA | ATACCTGGGCAACCTTGTAACTGTATTCTCCAGGCAGCACATGCGG    c.6300
 A  C  R  E  Q  |  Y  L  G  N  L  V  T  V  F  S  R  Q  H  M  R      p.2100

          .         .         .         . | 38       .         .    g.177661
 TGGCTCTGGGACATTGGTGGGAGAAAGTCCTTTTGGATAG | GTTTGAACGACCAAGTGCAT    c.6360
 W  L  W  D  I  G  G  R  K  S  F  W  I  G |   L  N  D  Q  V  H      p.2120

          .         .         .         .         .         .       g.177721
 GCTGGCCACTGGGAGTGGATCGGTGGTGAACCTGTTGCCTTCACCAATGGGAGAAGAGGG       c.6420
 A  G  H  W  E  W  I  G  G  E  P  V  A  F  T  N  G  R  R  G         p.2140

          .         .         .         .         .         .       g.177781
 CCCTCTCAACGCTCCAAGCTTGGAAAGAGCTGTGTTTTGGTTCAAAGACAAGGGAAATGG       c.6480
 P  S  Q  R  S  K  L  G  K  S  C  V  L  V  Q  R  Q  G  K  W         p.2160

          .         .         .         .         .         .       g.177841
 CAAACAAAAGACTGTAGGAGAGCCAAACCTCATAATTATGTGTGTTCCAGAAAACTCTAA       c.6540
 Q  T  K  D  C  R  R  A  K  P  H  N  Y  V  C  S  R  K  L  X         p.2179

          .         .         .         .         .         .       g.177901
 atataacagaccctacagggggccacctggagtttgtcacctatttattcacaggatctg       c.*60

          .         .         .         .         .         .       g.177961
 tgaatattgctccatagaaaacaaattgttatgattgagtgggtatacctttgtgattct       c.*120

          .         .         .         .         .         .       g.178021
 gtctagtgaaaatgggacatttttaatagtgccagaaagattgataaataaatatttttt       c.*180

          .         .         .         .         .         .       g.178081
 acaagataagatacaatttttgtatctcaataccttttaaaataaatgccagcagtatta       c.*240

          .         .         .         .         .         .       g.178141
 taaagtgtaaggtttgtttattccagaagaccctcacccttaccccattccaaatctcag       c.*300

          .         .         .         .         .         .       g.178201
 ggagcaccagtctcatagtccttggatttttttaaaaaaaatttttggtcccgttacctc       c.*360

          .         .         .         .         .         .       g.178261
 taatgaatttattctgaaatatgtatcgtaggtgctcctaccactttagtctgagtgaag       c.*420

          .         .         .         .         .         .       g.178321
 ctaactctactagttcattaaaccaaagttgaaccgcaaagttgtccctttggagccctt       c.*480

          .         .         .         .         .         .       g.178381
 taaatgtgaaatctaagattagaggctggggttgaaaaagagaattttctatgatgaaaa       c.*540

          .         .         .         .         .         .       g.178441
 agaaagactttagatgaaagaatcttgtaggtggaggctcatctacaaagctgtagttca       c.*600

          .         .         .         .         .         .       g.178501
 ggtaagaattcggggggctggctgtactcagagttctactcatcactattcatgaaacag       c.*660

          .         .         .         .         .         .       g.178561
 atctccctttccaatttgagtgttggcattgtaccatcccaaagctaatgattgggtttc       c.*720

          .         .         .         .         .         .       g.178621
 cccagccttacagagtcatgagaaatttcaagtaacataatctgttcctctgtgtttatt       c.*780

          .         .         .         .         .         .       g.178681
 gtactgacaagcatttctcagggacacttgggataaggagtatatatgaatgatggttga       c.*840

          .         .         .         .         .         .       g.178741
 cacatggaagaaaaatactgcttcctcagaaatgtcctgatgaactgtgctgatgaacag       c.*900

          .         .         .         .         .         .       g.178801
 agaaaaataataccgaaaacagagcccctgaaagcctacattctcggaaaggattttgag       c.*960

          .         .         .         .         .         .       g.178861
 gaattttgagccaccttaaatctttaatatttgcagaaatgccatgttaactagattctc       c.*1020

          .         .         .         .         .         .       g.178921
 taacggaaaggtaccttattaatttataatctcaggtgagtggaacatttttgtaacaat       c.*1080

          .         .         .         .         .         .       g.178981
 gaagtatgttgcagcgttaccagaactcccttctgaaatcaaggtttaacagttatagga       c.*1140

          .         .         .         .         .         .       g.179041
 aattagaatgtctgaaacatttatttaaagtttttctcttttcataatcactgagaaata       c.*1200

          .         .         .         .         .         .       g.179101
 tggttgtgccaaatgtcacttgctctatgagcaccaatgtaacttcagaatcaaattggg       c.*1260

          .         .         .         .         .         .       g.179161
 gttatcaagtaggctagagctctggtgctggttttattataaaaataccttgagtgttgt       c.*1320

          .         .         .         .         .         .       g.179221
 agacactaaaactgcttgaagaaagtcagttcagtttctgggatataaaaacatggcaag       c.*1380

          .         .         .         .         .         .       g.179281
 ctttttttatttcagttcatttatcaaggttgtaattaatagaaacatttagaaagagat       c.*1440

          .         .         .         .         .         .       g.179341
 attggaatatgatccagacattctgtctattacttaaatctaaacataattatagtgtca       c.*1500

          .         .         .         .         .         .       g.179401
 gagggtccttacctgagatgtcgcaggtgggctccagattggcataatgtacaggttctc       c.*1560

          .         .         .         .         .         .       g.179461
 tgtgagacacaagcagtttctggcatttaaccaaaagatgccacacctatcctcttacca       c.*1620

          .         .         .         .         .         .       g.179521
 gctcctttcaaattccttctggtccacaggcttcttgcagtatggaaatgtgagatttgg       c.*1680

          .         .         .         .         .         .       g.179581
 gctaaagaaaaaatagttgtttacctaaagggttaagtcctaggaaggaagtagaagttt       c.*1740

          .         .         .         .         .         .       g.179641
 gggaaatgagggattcaagggccactccttccactggaactctaaaactatataaaccat       c.*1800

          .         .         .         .         .         .       g.179701
 ctaaaactggaaatctagaactatgtcaactgtgtagaaccttgtcagcatggcagattt       c.*1860

          .         .         .         .         .         .       g.179761
 attatacatttctgcaatataaatgataaatgatactgaactaattgcaaatgttagcat       c.*1920

          .         .         .         .         .         .       g.179821
 aaagagtgttttgatttttataacaattagaaatgctacaagaatatttaaaaatattcc       c.*1980

          .         .         .         .         .         .       g.179881
 tgatcatgaaagcattaatcaaattagaaaatccaagtcattttaagaagataaaaatag       c.*2040

          .         .         .         .         .         .       g.179941
 aaattcaggcaagtttgggtgatgggcggtattcatcacaaccttcattttattcttaca       c.*2100

          .         .         .         .         .         .       g.180001
 attgagctttgactcagggggaaaagaagtaaatgattgtcaaggttccctctgccttga       c.*2160

          .         .         .         .         .         .       g.180061
 ttgatagtttctgatgggagtgggaaggaaggaattggagtaatgggtagaatgggaatg       c.*2220

          .         .         .         .         .         .       g.180121
 agagattacgggagagagagatgagatgggttgaacagaagaggatgggaactgatggta       c.*2280

          .         .         .         .         .         .       g.180181
 gctaggaaggaaagcgtcaagaaggacctgaatgtacccagcttttctccccaaacttca       c.*2340

          .         .         .         .         .         .       g.180241
 ataccacctcaggaaaaggcccactgtgtccaggggcgtcagtccagctcaatagtgtct       c.*2400

          .         .         .         .         .         .       g.180301
 agcttttcagaatcttctgattgtttggtctttaacaaaaacatagcatctatttgctaa       c.*2460

          .         .         .         .         .         .       g.180361
 caataaacttaagcaacatatgataatcatttcatctccttccaagaagtggtgaaaatg       c.*2520

          .         .         .         .         .         .       g.180421
 aaccaggtgacattaatttaacttctgtttttgtttatttttaatacaaccaaaaagata       c.*2580

          .         .         .         .         .         .       g.180481
 tgcacatattttaatttacattatggtactgtataatttaaaccataaactggtgctgat       c.*2640

          .         .         .         .         .         .       g.180541
 taatttctgcaacaaagcagcatattaaatgtactacatctagtgttgtagcaaaattaa       c.*2700

          .         .         .                                     g.180571
 taaacttgttttaagttctgagacactttc                                     c.*2730

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The FRAS1 related extracellular matrix 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 35
©2004-2018 Leiden University Medical Center