FRAS1 related extracellular matrix protein 2 (FREM2) - coding DNA reference sequence

(used for mutation description)

(last modified April 19, 2018)


This file was created to facilitate the description of sequence variants in the FREM2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from VERSION NG_008125.2, covering FREM2 transcript NM_207361.5.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                                    g.4916
                                                    gggatttcc       c.-301

 .         .         .         .         .         .                g.4976
 ctcaaagcccagggtccggggacctggaaagtagaagtggagggattcaattctccgcgc       c.-241

 .         .         .         .         .         .                g.5036
 gattgaggcgctagcggcggagctggacggcctgggaaggcttcggctcctcggctgcgg       c.-181

 .         .         .         .         .         .                g.5096
 ctccagcccggacggcgccgcgcaactttgccatccttctggcccagccccggctacagg       c.-121

 .         .         .         .         .         .                g.5156
 aggaccccgcgggcaacgcgcggagttcctggcacttcccggcggtgtctcttgttgtct       c.-61

 .         .         .         .         .         .                g.5216
 gcccggggaccgacttcgcatgctctcaggctgacctgtccaagcccgaacaccgggacc       c.-1

          .         .         .         .         .         .       g.5276
 ATGCACTCAGCCGGGACTCCCGGGTTATCCTCGCGCCGGACAGGCAACTCCACCAGCTTT       c.60
 M  H  S  A  G  T  P  G  L  S  S  R  R  T  G  N  S  T  S  F         p.20

          .         .         .         .         .         .       g.5336
 CAACCAGGACCGCCACCGCCGCCCCGGCTGCTGCTGCTGCTGCTGCTTCTCCTGTCACTG       c.120
 Q  P  G  P  P  P  P  P  R  L  L  L  L  L  L  L  L  L  S  L         p.40

          .         .         .         .         .         .       g.5396
 GTAAGCCGCGTCCCGGCACAGCCCGCTGCCTTCGGCAGGGCGTTGCTGTCCCCTGGTCTC       c.180
 V  S  R  V  P  A  Q  P  A  A  F  G  R  A  L  L  S  P  G  L         p.60

          .         .         .         .         .         .       g.5456
 GCGGGGGCTGCAGGGGTCCCTGCTGAGGAGGCCATAGTGCTGGCGAACCGCGGACTCCGG       c.240
 A  G  A  A  G  V  P  A  E  E  A  I  V  L  A  N  R  G  L  R         p.80

          .         .         .         .         .         .       g.5516
 GTGCCTTTCGGCCGTGAAGTCTGGCTGGATCCCCTGCATGACCTGGTGTTGCAGGTGCAG       c.300
 V  P  F  G  R  E  V  W  L  D  P  L  H  D  L  V  L  Q  V  Q         p.100

          .         .         .         .         .         .       g.5576
 CCCGGGGACCGCTGCGCGGTTTCGGTACTAGACAACGACGCACTGGCCCAGCGACCGGGC       c.360
 P  G  D  R  C  A  V  S  V  L  D  N  D  A  L  A  Q  R  P  G         p.120

          .         .         .         .         .         .       g.5636
 CGCCTGAGTCCCAAGCGCTTCCCGTGCGACTTTGGCCCTGGCGAGGTGCGCTACTCTCAC       c.420
 R  L  S  P  K  R  F  P  C  D  F  G  P  G  E  V  R  Y  S  H         p.140

          .         .         .         .         .         .       g.5696
 CTGGGCGCGCGCAGCCCGTCTCGGGACCGCGTCCGGCTGCAGCTGCGCTATGACGCGCCC       c.480
 L  G  A  R  S  P  S  R  D  R  V  R  L  Q  L  R  Y  D  A  P         p.160

          .         .         .         .         .         .       g.5756
 GGAGGGGCAGTAGTGCTACCACTGGTACTGGAGGTGGAGGTGGTCTTCACCCAGCTGGAG       c.540
 G  G  A  V  V  L  P  L  V  L  E  V  E  V  V  F  T  Q  L  E         p.180

          .         .         .         .         .         .       g.5816
 GTTGTGACTCGGAACTTGCCTCTGGTCGTGGAAGAGCTGCTGGGGACCAGCAATGCCCTG       c.600
 V  V  T  R  N  L  P  L  V  V  E  E  L  L  G  T  S  N  A  L         p.200

          .         .         .         .         .         .       g.5876
 GACGCGCGGAGCCTGGAGTTCGCCTTCCAGCCCGAGACAGAGGAGTGCCGCGTGGGCATC       c.660
 D  A  R  S  L  E  F  A  F  Q  P  E  T  E  E  C  R  V  G  I         p.220

          .         .         .         .         .         .       g.5936
 CTGTCCGGCTTGGGCGCGCTGCCTCGCTATGGAGAACTCCTCCACTACCCGCAGGTCCCT       c.720
 L  S  G  L  G  A  L  P  R  Y  G  E  L  L  H  Y  P  Q  V  P         p.240

          .         .         .         .         .         .       g.5996
 GGAGGAGCCAGAGAGGGAGGCGCCCCGGAGACTCTCCTGATGGACTGCAAAGCTTTCCAG       c.780
 G  G  A  R  E  G  G  A  P  E  T  L  L  M  D  C  K  A  F  Q         p.260

          .         .         .         .         .         .       g.6056
 GAACTAGGCGTGCGCTATCGCCACACAGCCGCCAGTCGCTCACCAAACAGGGACTGGATA       c.840
 E  L  G  V  R  Y  R  H  T  A  A  S  R  S  P  N  R  D  W  I         p.280

          .         .         .         .         .         .       g.6116
 CCCATGGTGGTGGAGCTGCGTTCACGAGGGGCTCCTGTGGGCAGCCCTGCTTTGAAACGC       c.900
 P  M  V  V  E  L  R  S  R  G  A  P  V  G  S  P  A  L  K  R         p.300

          .         .         .         .         .         .       g.6176
 GAGCACTTCCAGGTTCTGGTGAGGATCCGAGGAGGGGCCGAGAACACTGCACCCAAGCCC       c.960
 E  H  F  Q  V  L  V  R  I  R  G  G  A  E  N  T  A  P  K  P         p.320

          .         .         .         .         .         .       g.6236
 AGTTTCGTGGCCATGATGATGATGGAGGTGGACCAGTTTGTACTGACGGCCCTGACCCCA       c.1020
 S  F  V  A  M  M  M  M  E  V  D  Q  F  V  L  T  A  L  T  P         p.340

          .         .         .         .         .         .       g.6296
 GACATGCTGGCAGCCGAGGATGCTGAGTCTCCCTCTGACCTGTTGATCTTCAACCTTACT       c.1080
 D  M  L  A  A  E  D  A  E  S  P  S  D  L  L  I  F  N  L  T         p.360

          .         .         .         .         .         .       g.6356
 TCTCCATTCCAGCCTGGCCAGGGCTACTTGGTGAGCACCGATGATCGCAGCCTGCCCCTT       c.1140
 S  P  F  Q  P  G  Q  G  Y  L  V  S  T  D  D  R  S  L  P  L         p.380

          .         .         .         .         .         .       g.6416
 TCCTCCTTCACTCAGAGGGATCTGCGGCTCCTGAAGATTGCCTACCAGCCCCCTTCTGAA       c.1200
 S  S  F  T  Q  R  D  L  R  L  L  K  I  A  Y  Q  P  P  S  E         p.400

          .         .         .         .         .         .       g.6476
 GACTCTGACCAGGAGCGCCTCTTTGAACTGGAATTGGAGGTAGTGGATCTAGAAGGAGCA       c.1260
 D  S  D  Q  E  R  L  F  E  L  E  L  E  V  V  D  L  E  G  A         p.420

          .         .         .         .         .         .       g.6536
 GCTTCAGACCCTTTTGCCTTCATGGTAGTGGTGAAGCCCATGAACACAATGGCTCCGGTG       c.1320
 A  S  D  P  F  A  F  M  V  V  V  K  P  M  N  T  M  A  P  V         p.440

          .         .         .         .         .         .       g.6596
 GTCACCCGGAATACCGGTCTTATTCTCTATGAGGGTCAGTCTCGGCCCCTCACAGGCCCT       c.1380
 V  T  R  N  T  G  L  I  L  Y  E  G  Q  S  R  P  L  T  G  P         p.460

          .         .         .         .         .         .       g.6656
 GCAGGCAGTGGTCCGCAAAACTTGGTCATCAGCGATGAGGATGACCTAGAAGCAGTGCGG       c.1440
 A  G  S  G  P  Q  N  L  V  I  S  D  E  D  D  L  E  A  V  R         p.480

          .         .         .         .         .         .       g.6716
 CTAGAGGTGGTGGCTGGGCTCCGGCATGGTCACCTTGTCATTCTGGGTGCTTCCAGTGGC       c.1500
 L  E  V  V  A  G  L  R  H  G  H  L  V  I  L  G  A  S  S  G         p.500

          .         .         .         .         .         .       g.6776
 AGCTCTGCTCCCAAGAGCTTTACAGTGGCTGAGCTGGCAGCCGGCCAGGTGGTCTACCAG       c.1560
 S  S  A  P  K  S  F  T  V  A  E  L  A  A  G  Q  V  V  Y  Q         p.520

          .         .         .         .         .         .       g.6836
 CATGATGACAGAGACGGCTCGCTGAGCGACAACCTGGTGCTTCGCATGGTGGATGGAGGA       c.1620
 H  D  D  R  D  G  S  L  S  D  N  L  V  L  R  M  V  D  G  G         p.540

          .         .         .         .         .         .       g.6896
 GGCAGGCACCAGGTACAGTTTCTGTTCCCCATCACCTTAGTGCCTGTGGATGACCAGCCA       c.1680
 G  R  H  Q  V  Q  F  L  F  P  I  T  L  V  P  V  D  D  Q  P         p.560

          .         .         .         .         .         .       g.6956
 CCTGTTCTCAATGCCAACACGGGGCTGACACTGGCAGAGGGTGAAACAGTGCCCATCCTG       c.1740
 P  V  L  N  A  N  T  G  L  T  L  A  E  G  E  T  V  P  I  L         p.580

          .         .         .         .         .         .       g.7016
 CCCCTTTCCCTGAGTGCAACTGACATGGATTCAGATGATTCTCTGCTGCTTTTTGTGCTG       c.1800
 P  L  S  L  S  A  T  D  M  D  S  D  D  S  L  L  L  F  V  L         p.600

          .         .         .         .         .         .       g.7076
 GAGTCACCCTTCTTAACTACGGGGCATCTGCTTCTCCGCCAAACTCACCCTCCCCATGAG       c.1860
 E  S  P  F  L  T  T  G  H  L  L  L  R  Q  T  H  P  P  H  E         p.620

          .         .         .         .         .         .       g.7136
 AAGCAGGAACTTCTCAGAGGCCTTTGGAGGAAGGAGGGGGCATTTTATGAGCGAACAGTG       c.1920
 K  Q  E  L  L  R  G  L  W  R  K  E  G  A  F  Y  E  R  T  V         p.640

          .         .         .         .         .         .       g.7196
 ACAGAGTGGCAGCAGCAGGACATAACAGAGGGCAGGCTGTTCTATAGACACTCTGGGCCC       c.1980
 T  E  W  Q  Q  Q  D  I  T  E  G  R  L  F  Y  R  H  S  G  P         p.660

          .         .         .         .         .         .       g.7256
 CATAGTCCTGGGCCAGTCACAGACCAGTTCACATTTAGAGTCCAGGATAACCATGACCCT       c.2040
 H  S  P  G  P  V  T  D  Q  F  T  F  R  V  Q  D  N  H  D  P         p.680

          .         .         .         .         .         .       g.7316
 CCTAATCAGTCCGGGCTACAGCGGTTTGTGATTCGTATCCATCCTGTGGATCGCCTCCCT       c.2100
 P  N  Q  S  G  L  Q  R  F  V  I  R  I  H  P  V  D  R  L  P         p.700

          .         .         .         .         .         .       g.7376
 CCGGAGCTGGGCAGTGGCTGTCCCCTTCGTATGGTGGTACAGGAATCCCAGCTCACACCA       c.2160
 P  E  L  G  S  G  C  P  L  R  M  V  V  Q  E  S  Q  L  T  P         p.720

          .         .         .         .         .         .       g.7436
 CTGAGGAAGAAGTGGCTGCGCTACACTGACCTGGACACAGATGACCGAGAACTACGTTAC       c.2220
 L  R  K  K  W  L  R  Y  T  D  L  D  T  D  D  R  E  L  R  Y         p.740

          .         .         .         .         .         .       g.7496
 ACAGTGACTCAGCCCCCCACAGACACAGACGAAAATCACCTGCCAGCCCCACTGGGTACC       c.2280
 T  V  T  Q  P  P  T  D  T  D  E  N  H  L  P  A  P  L  G  T         p.760

          .         .         .         .         .         .       g.7556
 TTGGTCTTGACTGACAACCCCTCAGTCGTGGTGACCCATTTTACCCAAGCCCAGATCAAC       c.2340
 L  V  L  T  D  N  P  S  V  V  V  T  H  F  T  Q  A  Q  I  N         p.780

          .         .         .         .         .         .       g.7616
 CATCATAAAATTGCTTACAGACCCCCGGGTCAAGAACTGGGCGTGGCTACTCGAGTGGCC       c.2400
 H  H  K  I  A  Y  R  P  P  G  Q  E  L  G  V  A  T  R  V  A         p.800

          .         .         .         .         .         .       g.7676
 CAGTTCCAGTTCCAGGTGGAAGACCGAGCTGGGAATGTGGCTCCAGGTACCTTTACCCTT       c.2460
 Q  F  Q  F  Q  V  E  D  R  A  G  N  V  A  P  G  T  F  T  L         p.820

          .         .         .         .         .         .       g.7736
 TACTTGCATCCCGTGGACAACCAGCCACCTGAGATCCTCAACACCGGCTTCACTATTCAG       c.2520
 Y  L  H  P  V  D  N  Q  P  P  E  I  L  N  T  G  F  T  I  Q         p.840

          .         .         .         .         .         .       g.7796
 GAGAAGGGTCACCACATCCTGAGTGAGACAGAGTTGCACGTGAATGATGTAGACACTGAT       c.2580
 E  K  G  H  H  I  L  S  E  T  E  L  H  V  N  D  V  D  T  D         p.860

          .         .         .         .         .         .       g.7856
 GTTGCCCATATCTCTTTCACTCTCACTCAGGCACCCAAACATGGCCACATGAGAGTGTCT       c.2640
 V  A  H  I  S  F  T  L  T  Q  A  P  K  H  G  H  M  R  V  S         p.880

          .         .         .         .         .         .       g.7916
 GGACAGATCCTGCATGTAGGGGGTCTCTTCCACTTGGAGGACATAAAACAGGGCCGAGTT       c.2700
 G  Q  I  L  H  V  G  G  L  F  H  L  E  D  I  K  Q  G  R  V         p.900

          .         .         .         .         .         .       g.7976
 TCCTATGCCCATAATGGGGACAAGTCCCTGACTGATAGCTGCTCCTTGGAAGTCAGTGAC       c.2760
 S  Y  A  H  N  G  D  K  S  L  T  D  S  C  S  L  E  V  S  D         p.920

          .         .         .         .         .         .       g.8036
 AGACATCATGTGGTGCCCATCACTCTCAGAGTAAATGTCCGGCCAGTGGATGATGAAGTG       c.2820
 R  H  H  V  V  P  I  T  L  R  V  N  V  R  P  V  D  D  E  V         p.940

          .         .         .         .         .         .       g.8096
 CCCATACTGAGCCATCCTACTGGCACTCTGGAGTCCTATCTAGATGTCTTAGAAAATGGG       c.2880
 P  I  L  S  H  P  T  G  T  L  E  S  Y  L  D  V  L  E  N  G         p.960

          .         .         .         .         .         .       g.8156
 GCTACTGAAATCACTGCCAATGTTATTAAGGGGACCAATGAGGAAACTGATGACTTGATG       c.2940
 A  T  E  I  T  A  N  V  I  K  G  T  N  E  E  T  D  D  L  M         p.980

          .         .         .         .         .         .       g.8216
 TTGACTTTCCTCTTGGAAGATCCACCTTTGTATGGGGAAATCTTGGTCAATGGCATTCCA       c.3000
 L  T  F  L  L  E  D  P  P  L  Y  G  E  I  L  V  N  G  I  P         p.1000

          .         .         .         .         .         .       g.8276
 GCAGAGCAGTTTACTCAAAGGGACATCTTGGAGGGCTCTGTTGTATATACCCACACCAGT       c.3060
 A  E  Q  F  T  Q  R  D  I  L  E  G  S  V  V  Y  T  H  T  S         p.1020

          .         .         .         .         .         .       g.8336
 GGTGAGATAGGCCTATTGCCTAAAGCGGATTCTTTTAACCTGAGTCTGTCAGATATGTCT       c.3120
 G  E  I  G  L  L  P  K  A  D  S  F  N  L  S  L  S  D  M  S         p.1040

          .         .         .         .         .         .       g.8396
 CAAGAATGGAGAATTGGTGGCAATACTATCCAAGGAGTTACTATATGGGTGACCATCCTG       c.3180
 Q  E  W  R  I  G  G  N  T  I  Q  G  V  T  I  W  V  T  I  L         p.1060

          .         .         .         .         .         .       g.8456
 CCTGTTGATAGCCAGGCCCCAGAAATCTTTGTAGGTGAACAGTTGATAGTAATGGAAGGT       c.3240
 P  V  D  S  Q  A  P  E  I  F  V  G  E  Q  L  I  V  M  E  G         p.1080

          .         .         .         .         .         .       g.8516
 GATAAAAGTGTTATAACATCAGTGCATATAAGTGCTGAAGATGTCGACTCCCTGAATGAT       c.3300
 D  K  S  V  I  T  S  V  H  I  S  A  E  D  V  D  S  L  N  D         p.1100

          .         .         .         .         .         .       g.8576
 GACATCTTGTGCACTATAGTTATTCAGCCTACTTCAGGTTATGTTGAAAACATTTCTCCA       c.3360
 D  I  L  C  T  I  V  I  Q  P  T  S  G  Y  V  E  N  I  S  P         p.1120

          .         .         .         .         .         .       g.8636
 GCACCAGGCTCTGAGAAATCAAGAGCAGGGATTGCCATAAGTGCTTTCAACTTGAAAGAT       c.3420
 A  P  G  S  E  K  S  R  A  G  I  A  I  S  A  F  N  L  K  D         p.1140

          .         .         .         .         .         .       g.8696
 CTCAGGCAGGGCCACATAAACTATGTCCAGAGTGTCCATAAAGGGGTGGAACCTGTGGAG       c.3480
 L  R  Q  G  H  I  N  Y  V  Q  S  V  H  K  G  V  E  P  V  E         p.1160

          .         .         .         .         .         .       g.8756
 GACCGATTTGTATTTCGTTGTTCTGATGGCATTAACTTTTCAGAGAGACAGTTCTTCCCC       c.3540
 D  R  F  V  F  R  C  S  D  G  I  N  F  S  E  R  Q  F  F  P         p.1180

          .         .         .         .         .         .       g.8816
 ATTGTAATCATTCCCACCAATGATGAACAGCCAGAGATGTTTATGAGAGAATTTATGGTG       c.3600
 I  V  I  I  P  T  N  D  E  Q  P  E  M  F  M  R  E  F  M  V         p.1200

          .         .         .         .         .         .       g.8876
 ATGGAAGGCATGAGTCTGGTAATTGATACACCCATTCTCAATGCTGCTGATGCTGATGTT       c.3660
 M  E  G  M  S  L  V  I  D  T  P  I  L  N  A  A  D  A  D  V         p.1220

          .         .         .         .         .         .       g.8936
 CCCCTGGATGATTTAACTTTCACTATTACCCAATTCCCCACTCATGGTCACATCATGAAT       c.3720
 P  L  D  D  L  T  F  T  I  T  Q  F  P  T  H  G  H  I  M  N         p.1240

          .         .         .         .         .         .       g.8996
 CAGCTGATAAATGGCACGGTTTTGGTCGAAAGCTTCACCTTGGATCAGATCATAGAGAGT       c.3780
 Q  L  I  N  G  T  V  L  V  E  S  F  T  L  D  Q  I  I  E  S         p.1260

          .         .         .         .         .         .       g.9056
 TCCAGCATTATTTATGAGCATGATGACTCCGAGACCCAGGAAGACAGTTTTGTGATTAAA       c.3840
 S  S  I  I  Y  E  H  D  D  S  E  T  Q  E  D  S  F  V  I  K         p.1280

          .         .         .         .         .         .       g.9116
 CTAACAGATGGGAAGCACTCTGTGGAAAAGACGGTCCTCATTATAGTTATCCCTGTTGAT       c.3900
 L  T  D  G  K  H  S  V  E  K  T  V  L  I  I  V  I  P  V  D         p.1300

          .         .         .         .         .         .       g.9176
 GATGAGACGCCCAGAATGACTATCAATAATGGACTAGAAATAGAAATTGGGGATACCAAG       c.3960
 D  E  T  P  R  M  T  I  N  N  G  L  E  I  E  I  G  D  T  K         p.1320

          .         .         .         .         .         .       g.9236
 ATTATCAACAACAAAATATTAATGGCAACAGATTTAGATTCAGAAGACAAATCTTTGGTT       c.4020
 I  I  N  N  K  I  L  M  A  T  D  L  D  S  E  D  K  S  L  V         p.1340

          .         .         .         .         .         .       g.9296
 TATATTATTCGTTATGGGCCAGGACATGGCTTATTACAGAGACGAAAACCTACTGGTGCC       c.4080
 Y  I  I  R  Y  G  P  G  H  G  L  L  Q  R  R  K  P  T  G  A         p.1360

          .         .         .         .         .         .       g.9356
 TTTGAAAATATCACACTGGGCATGAATTTTACCCAGGATGAAGTAGACAGAAACTTAATT       c.4140
 F  E  N  I  T  L  G  M  N  F  T  Q  D  E  V  D  R  N  L  I         p.1380

          .         .         .         .         .         .       g.9416
 CAGTATGTCCATTTGGGGCAAGAGGGCATTCGGGACCTAATTAAATTTGATGTGACTGAT       c.4200
 Q  Y  V  H  L  G  Q  E  G  I  R  D  L  I  K  F  D  V  T  D         p.1400

          .         .         .         .         .         .       g.9476
 GGAATAAATCCCCTCATAGATCGTTACTTTTATGTGTCCATCGGGAGCATTGACATTGTC       c.4260
 G  I  N  P  L  I  D  R  Y  F  Y  V  S  I  G  S  I  D  I  V         p.1420

          .         .         .         .         .         .       g.9536
 TTCCCTGATGTGATAAGTAAGGGAGTGTCCTTGAAAGAAGGTGGCAAAGTCACTCTTACA       c.4320
 F  P  D  V  I  S  K  G  V  S  L  K  E  G  G  K  V  T  L  T         p.1440

          .         .         .         .         .         .       g.9596
 ACAGACCTACTAAGCACTAGTGACTTGAACAGTCCTGATGAAAACTTGGTTTTTACCATC       c.4380
 T  D  L  L  S  T  S  D  L  N  S  P  D  E  N  L  V  F  T  I         p.1460

          .         .         .         .         .         .       g.9656
 ACCAGGGCTCCCATGCGAGGTCACCTGGAATGCACGGATCAGCCTGGTGTGTCCATCACG       c.4440
 T  R  A  P  M  R  G  H  L  E  C  T  D  Q  P  G  V  S  I  T         p.1480

          .         .         .         .         .         .       g.9716
 TCTTTCACTCAGCTGCAACTGGCTGGAAACAAAATCTACTACATCCACACAGCTGATGAT       c.4500
 S  F  T  Q  L  Q  L  A  G  N  K  I  Y  Y  I  H  T  A  D  D         p.1500

          .         .         .         .         .         .       g.9776
 GAAGTGAAAATGGACAGTTTTGAGTTTCAAGTCACCGATGGACGTAACCCTGTCTTTCGG       c.4560
 E  V  K  M  D  S  F  E  F  Q  V  T  D  G  R  N  P  V  F  R         p.1520

          .         .         .         .         .         .       g.9836
 ACATTCCGTATCTCCATTAGCGATGTGGACAATAAAAAGCCAGTGGTCACCATCCACAAG       c.4620
 T  F  R  I  S  I  S  D  V  D  N  K  K  P  V  V  T  I  H  K         p.1540

          .         .         .         .         .         .       g.9896
 CTGGTTGTCAGTGAAAGTGAAAACAAGCTGATTACTCCTTTTGAGCTCACTGTCGAAGAC       c.4680
 L  V  V  S  E  S  E  N  K  L  I  T  P  F  E  L  T  V  E  D         p.1560

          .         .         .         .         .         .       g.9956
 AGAGATACTCCTGACAAGCTCCTGAAATTCACTATCACCCAGGTGCCTATTCATGGCCAT       c.4740
 R  D  T  P  D  K  L  L  K  F  T  I  T  Q  V  P  I  H  G  H         p.1580

          .         .         .         .         .         .       g.10016
 CTCCTATTCAACAATACCAGACCTGTCATGGTTTTTACCAAGCAAGACTTGAATGAAAAC       c.4800
 L  L  F  N  N  T  R  P  V  M  V  F  T  K  Q  D  L  N  E  N         p.1600

          .         .         .         .         .         .       g.10076
 TTAATCAGCTACAAACATGATGGCACTGAGTCAAGTGAAGATAGCTTCTCCTTCACAGTG       c.4860
 L  I  S  Y  K  H  D  G  T  E  S  S  E  D  S  F  S  F  T  V         p.1620

          .         .         .         .         .         .       g.10136
 ACTGATGGCACCCATACAGACTTCTATGTTTTTCCTGATACGGTGTTTGAAACAAGGAGA       c.4920
 T  D  G  T  H  T  D  F  Y  V  F  P  D  T  V  F  E  T  R  R         p.1640

          .         .         .         .         .         .       g.10196
 CCCCAAGTGATGAAGATCCAGGTCTTGGCTGTTGACAACAGTGTCCCCCAAATCGCAGTG       c.4980
 P  Q  V  M  K  I  Q  V  L  A  V  D  N  S  V  P  Q  I  A  V         p.1660

          .         .         .         .         .         .       g.10256
 AATAAGGGGGCCTCTACACTTCGCACTCTAGCCACTGGCCACTTGGGGTTCATGATCACA       c.5040
 N  K  G  A  S  T  L  R  T  L  A  T  G  H  L  G  F  M  I  T         p.1680

          .         .         .         .         .         .       g.10316
 AGCAAAATATTGAAAGTGGAGGACAGAGACAGCTTACACATTTCTCTTAGATTTATCGTG       c.5100
 S  K  I  L  K  V  E  D  R  D  S  L  H  I  S  L  R  F  I  V         p.1700

          .         .         .         .         .         .       g.10376
 ACAGAGGCCCCTCAACATGGATATCTTCTCAACCTGGACAAAGGCAACCACAGCATCACT       c.5160
 T  E  A  P  Q  H  G  Y  L  L  N  L  D  K  G  N  H  S  I  T         p.1720

          .    | 02    .         .         .         .         .    g.15616
 CAGTTCACACAAG | CTGACATTGATGACATGAAAATATGCTATGTCTTAAGAGAAGGGGCT    c.5220
 Q  F  T  Q  A |   D  I  D  D  M  K  I  C  Y  V  L  R  E  G  A      p.1740

          .         .         .         .    | 03    .         .    g.82192
 AATGCCACAAGTGATATGTTCTATTTTGCAGTTGAAGATGGTG | GTGGAAACAAGTTAACG    c.5280
 N  A  T  S  D  M  F  Y  F  A  V  E  D  G  G |   G  N  K  L  T      p.1760

          .         .         .         .         .         .       g.82252
 TACCAGAATTTTCGTCTGAATTGGGCATGGATCTCCTTTGAAAAGGAATATTACCTGGTC       c.5340
 Y  Q  N  F  R  L  N  W  A  W  I  S  F  E  K  E  Y  Y  L  V         p.1780

          .         .         .         .         .         .       g.82312
 AATGAGGACTCCAAATTTCTAGATGTTGTTCTTAAACGTAGAGGTTACTTGGGAGAAACT       c.5400
 N  E  D  S  K  F  L  D  V  V  L  K  R  R  G  Y  L  G  E  T         p.1800

          . | 04       .         .         .         .         .    g.87499
 TCTTTTATAA | GTATTGGCACAAGAGACAGAACTGCAGAAAAAGACAAAGACTTCAAGGGC    c.5460
 S  F  I  S |   I  G  T  R  D  R  T  A  E  K  D  K  D  F  K  G      p.1820

          .         .         .         .         .         .       g.87559
 AAAGCACAGAAACAAGTGCAGTTCAACCCAGGCCAGACCAGGGCCACATGGCGAGTGCGG       c.5520
 K  A  Q  K  Q  V  Q  F  N  P  G  Q  T  R  A  T  W  R  V  R         p.1840

          .         .         .         .         .         .       g.87619
 ATCCTGAGTGATGGGGAGCATGAGCAGTCTGAAACCTTTCAGGTGGTACTCTCAGAGCCC       c.5580
 I  L  S  D  G  E  H  E  Q  S  E  T  F  Q  V  V  L  S  E  P         p.1860

          .         .         .         .         .         .       g.87679
 GTGCTGGCTGCCTTGGAATTCCCCACAGTCGCCACTGTTGAGATCGTTGATCCAGGAGAT       c.5640
 V  L  A  A  L  E  F  P  T  V  A  T  V  E  I  V  D  P  G  D         p.1880

   | 05      .         .         .         .         .         .    g.101000
 G | AGCCAACTGTGTTTATTCCCCAGTCCAAATACTCCGTTGAAGAAGATGTTGGTGAGCTG    c.5700
 E |   P  T  V  F  I  P  Q  S  K  Y  S  V  E  E  D  V  G  E  L      p.1900

          .         .         .         .         .         .       g.101060
 TTCATTCCCATCAGGAGGAGCGGAGATGTGAGCCAGGAGTTGATGGTGGTCTGTTATACC       c.5760
 F  I  P  I  R  R  S  G  D  V  S  Q  E  L  M  V  V  C  Y  T         p.1920

         | 06.         .         .         .         .         .    g.102481
 CAACAAG | GAACAGCAACTGGAACTGTGCCGACTTCCGTGTTGTCTTACTCTGATTACATA    c.5820
 Q  Q  G |   T  A  T  G  T  V  P  T  S  V  L  S  Y  S  D  Y  I      p.1940

          .         .         .         .         .         .       g.102541
 TCCAGGCCTGAGGACCACACCAGTGTTGTCCGCTTTGACAAAGATGAACGGGAGAAACTG       c.5880
 S  R  P  E  D  H  T  S  V  V  R  F  D  K  D  E  R  E  K  L         p.1960

          .         .         .         .         .         .       g.102601
 TGTCGGATAGTCATAATTGATGACTCTTTGTACGAGGAGGAGGAAACCTTCCATGTCCTT       c.5940
 C  R  I  V  I  I  D  D  S  L  Y  E  E  E  E  T  F  H  V  L         p.1980

          .         .         .         .         .         .       g.102661
 CTGAGCATGCCCATGGGGGGAAGAATCGGATCAGAGTTCCCAGGGGCTCAAGTTACAATC       c.6000
 L  S  M  P  M  G  G  R  I  G  S  E  F  P  G  A  Q  V  T  I         p.2000

          .          | 07        .         .         .         .    g.164485
 GTTCCTGACAAAGATGATG | AACCCATCTTTTACTTCGGTGATGTGGAATACTCTGTGGAT    c.6060
 V  P  D  K  D  D  E |   P  I  F  Y  F  G  D  V  E  Y  S  V  D      p.2020

          .         .         .         .         .         .       g.164545
 GAGAGTGCTGGCTATGTGGAAGTGCAGGTGTGGAGAACGGGCACTGACCTGTCCAAGTCT       c.6120
 E  S  A  G  Y  V  E  V  Q  V  W  R  T  G  T  D  L  S  K  S         p.2040

          .         .         .         .          | 08        .    g.166343
 TCTAGTGTCACAGTGAGGTCTCGGAAAACAGATCCTCCCTCTGCAGATG | CTGGAACAGAC    c.6180
 S  S  V  T  V  R  S  R  K  T  D  P  P  S  A  D  A |   G  T  D      p.2060

          .         .         .         .         .         .       g.166403
 TATGTGGGCATCAGCCGTAATTTAGATTTTGCACCTGGAGTCAACATGCAGCCTGTTCGT       c.6240
 Y  V  G  I  S  R  N  L  D  F  A  P  G  V  N  M  Q  P  V  R         p.2080

          .         .         .         .         .         .       g.166463
 GTTGTCATTCTGGATGACCTTGGACAACCAGCGCTGGAGGGAATTGAGAAATTTGAACTG       c.6300
 V  V  I  L  D  D  L  G  Q  P  A  L  E  G  I  E  K  F  E  L         p.2100

          .         .         .         .         .         .       g.166523
 GTGCTTCGCATGCCTATGAACGCAGCCCTTGGCGAGCCCAGCAAAGCCACAGTGTCCATA       c.6360
 V  L  R  M  P  M  N  A  A  L  G  E  P  S  K  A  T  V  S  I         p.2120

          .          | 09        .         .         .         .    g.167950
 AATGACTCTGTCTCCGATT | TGCCTAAGATGCAATTCAAAGAACGAATATATACTGGCAGC    c.6420
 N  D  S  V  S  D  L |   P  K  M  Q  F  K  E  R  I  Y  T  G  S      p.2140

          .         .         .         .         .         .       g.168010
 GAAAGTGATGGGCAGATAGTTACAATGATCCATAGGACTGGGGATGTCCAGTACAGATCT       c.6480
 E  S  D  G  Q  I  V  T  M  I  H  R  T  G  D  V  Q  Y  R  S         p.2160

          .         .         .         .         .         .       g.168070
 TCAGTGAGATGCTACACCCGGCAGGGGTCTGCACAGGTGATGATGGACTTTGAAGAACGC       c.6540
 S  V  R  C  Y  T  R  Q  G  S  A  Q  V  M  M  D  F  E  E  R         p.2180

          .         .         .        | 10.         .         .    g.168838
 CCAAACACTGATACCTCCATCATCACATTCCTCCCTG | GTGAGACAGAAAAGCCCTGCATT    c.6600
 P  N  T  D  T  S  I  I  T  F  L  P  G |   E  T  E  K  P  C  I      p.2200

          .         .         .         .         .         .       g.168898
 CTTGAGCTGATGGACGATGTGCTCTATGAGGAGGTAGAGGAGCTCCGCCTGGTACTCGGC       c.6660
 L  E  L  M  D  D  V  L  Y  E  E  V  E  E  L  R  L  V  L  G         p.2220

          .         .         .         .         .         .       g.168958
 ACTCCACAAAGCAACTCTCCCTTTGGGGCTGCAGTTGGTGAACAAAATGAAACTCTCATA       c.6720
 T  P  Q  S  N  S  P  F  G  A  A  V  G  E  Q  N  E  T  L  I         p.2240

          .         .   | 11     .         .         .         .    g.169595
 AGGATCCGAGATGATGCTGATA | AGACTGTTATTAAATTTGGAGAAACCAAATTTAGTGTC    c.6780
 R  I  R  D  D  A  D  K |   T  V  I  K  F  G  E  T  K  F  S  V      p.2260

          .         .         .         .         .         .       g.169655
 ACTGAACCCAAAGAACCTGGAGAGTCGGTGGTTATAAGAATTCCAGTGATTCGCCAAGGA       c.6840
 T  E  P  K  E  P  G  E  S  V  V  I  R  I  P  V  I  R  Q  G         p.2280

          .         .         .         .         .         .       g.169715
 GACACTTCAAAGGTTTCCATTGTGAGAGTCCACACCAAGGATGGCTCGGCCACCTCTGGA       c.6900
 D  T  S  K  V  S  I  V  R  V  H  T  K  D  G  S  A  T  S  G         p.2300

          .         .      | 12  .         .         .         .    g.174032
 GAAGACTACCACCCTGTGTCAGAAG | AAATTGAGTTTAAGGAAGGGGAAACCCAGCACGTG    c.6960
 E  D  Y  H  P  V  S  E  E |   I  E  F  K  E  G  E  T  Q  H  V      p.2320

          .         .         .         .         .         .       g.174092
 GTTGAAATCGAAGTTACCTTTGACGGGGTGAGAGAGATGAGAGAGGCCTTCACTGTTCAC       c.7020
 V  E  I  E  V  T  F  D  G  V  R  E  M  R  E  A  F  T  V  H         p.2340

          .         .         .       | 13 .         .         .    g.175770
 CTAAAACCTGATGAAAATATGATAGCAGAGATGCAG | TTGACGAAAGCCATTGTGTACATA    c.7080
 L  K  P  D  E  N  M  I  A  E  M  Q   | L  T  K  A  I  V  Y  I      p.2360

          .         .         .         .         .         .       g.175830
 GAAGAAATGAGCAGCATGGCAGATGTCACTTTTCCTTCTGTCCCTCAAATTGTATCCCTG       c.7140
 E  E  M  S  S  M  A  D  V  T  F  P  S  V  P  Q  I  V  S  L         p.2380

          .         .         .         .         .         .       g.175890
 TTGATGTATGACGACACTTCCAAAGCTAAGGAGAGTGCTGAACCCATGTCTGGCTATCCT       c.7200
 L  M  Y  D  D  T  S  K  A  K  E  S  A  E  P  M  S  G  Y  P         p.2400

          .      | 14  .         .         .         .         .    g.177203
 GTCATCTGTATCACA | GCTTGCAACCCCAAATATTCAGACTACGATAAAACAGGCTCTATC    c.7260
 V  I  C  I  T   | A  C  N  P  K  Y  S  D  Y  D  K  T  G  S  I      p.2420

          .         .         .         .         .         .       g.177263
 TGTGCAAGTGAGAACATCAATGACACTTTGACGCGGTACCGGTGGCTGATTAGTGCACCT       c.7320
 C  A  S  E  N  I  N  D  T  L  T  R  Y  R  W  L  I  S  A  P         p.2440

          .         .         .         .         .         .       g.177323
 GCGGGCCCTGACGGTGTGACCAGCCCTATGAGAGAAGTGGACTTCGACACCTTTTTTACG       c.7380
 A  G  P  D  G  V  T  S  P  M  R  E  V  D  F  D  T  F  F  T         p.2460

          .         .         .         .         .         .       g.177383
 TCATCCAAGATGGTCACACTGGACTCCATATACTTTCAGCCTGGCTCCCGGGTACAGTGC       c.7440
 S  S  K  M  V  T  L  D  S  I  Y  F  Q  P  G  S  R  V  Q  C         p.2480

          .         .         .         .         .         .       g.177443
 GCAGCTCGTGCTGTGAACACCAATGGGGATGAAGGCCTGGAGCTCATGAGCCCTATTGTA       c.7500
 A  A  R  A  V  N  T  N  G  D  E  G  L  E  L  M  S  P  I  V         p.2500

          .          | 15        .         .         .         .    g.179343
 ACCATCAGCAGAGAAGAAG | GTCTTTGTCAGCCCCGTGTACCTGGGGTTGTTGGAGCAGAG    c.7560
 T  I  S  R  E  E  G |   L  C  Q  P  R  V  P  G  V  V  G  A  E      p.2520

          .         .         .         .         .         .       g.179403
 CCGTTCTCAGCTAAATTGCGCTACACAGGCCCTGAGGATGCAGACTACACAAACCTTATC       c.7620
 P  F  S  A  K  L  R  Y  T  G  P  E  D  A  D  Y  T  N  L  I         p.2540

          .         .         .  | 16      .         .         .    g.182175
 AAGCTCACTGTCACAATGCCACACATAGATG | GCATGCTCCCCGTGATCTCCACTAGAGAG    c.7680
 K  L  T  V  T  M  P  H  I  D  G |   M  L  P  V  I  S  T  R  E      p.2560

          .         .         .         .         .         .       g.182235
 CTTTCCAACTTTGAGCTCACCCTCAGCCCTGATGGCACAAGAGTTGGAAACCACAAGTGC       c.7740
 L  S  N  F  E  L  T  L  S  P  D  G  T  R  V  G  N  H  K  C         p.2580

          .         .         .         .         .         .       g.182295
 TCCAACCTCCTGGATTATACTGAAGTGAAGACTCATTATGGTTTCTTGACTGATGCTACC       c.7800
 S  N  L  L  D  Y  T  E  V  K  T  H  Y  G  F  L  T  D  A  T         p.2600

          .         .         .         .         .         .       g.182355
 AAAAATCCAGAAATAATTGGAGAGACATATCCTTACCAGTACAGCTTGTCCATCAGAGGT       c.7860
 K  N  P  E  I  I  G  E  T  Y  P  Y  Q  Y  S  L  S  I  R  G         p.2620

          .         .         .         .         .         .       g.182415
 TCCACTACCTTGCGCTTCTACCGGAACCTGAACCTAGAGGCCTGTTTATGGGAGTTCGTT       c.7920
 S  T  T  L  R  F  Y  R  N  L  N  L  E  A  C  L  W  E  F  V         p.2640

          .         .         .         .         .         .       g.182475
 AGCTACTATGACATGTCAGAACTCCTTGCTGACTGTGGTGGCACCATTGGAACAGATGGA       c.7980
 S  Y  Y  D  M  S  E  L  L  A  D  C  G  G  T  I  G  T  D  G         p.2660

     | 17    .         .         .         .         .         .    g.190670
 CAG | GTCCTAAACCTAGTGCAGTCCTATGTGACCCTTCGAGTCCCTCTGTATGTTTCCTAC    c.8040
 Q   | V  L  N  L  V  Q  S  Y  V  T  L  R  V  P  L  Y  V  S  Y      p.2680

          .         .         .         .         .         .       g.190730
 GTGTTCCATTCCCCCGTGGGGGTAGGAGGCTGGCAGCATTTTGACTTGAAGTCAGAGCTT       c.8100
 V  F  H  S  P  V  G  V  G  G  W  Q  H  F  D  L  K  S  E  L         p.2700

          .         .         .         .         .         .       g.190790
 CGTCTAACTTTTGTGTACGACACCGCCATCTTGTGGAATGATGGAATTGGCAGCCCCCCA       c.8160
 R  L  T  F  V  Y  D  T  A  I  L  W  N  D  G  I  G  S  P  P         p.2720

          .       | 18 .         .         .         .         .    g.192397
 GAGGCTGAACTTCAAG | GTTCTCTCTATCCAACCAGCATGCGCATCGGTGATGAGGGGCGC    c.8220
 E  A  E  L  Q  G |   S  L  Y  P  T  S  M  R  I  G  D  E  G  R      p.2740

          .         .         .         .         .         .       g.192457
 TTGGCCGTGCACTTCAAGACAGAGGCTCAGTTCCATGGCTTATTTGTGCTGTCACATCCC       c.8280
 L  A  V  H  F  K  T  E  A  Q  F  H  G  L  F  V  L  S  H  P         p.2760

   | 19      .         .         .         .         .         .    g.193952
 G | CATCCTTTACAAGCTCAGTGATCATGTCAGCTGATCATCCAGGCCTGACATTTTCCCTC    c.8340
 A |   S  F  T  S  S  V  I  M  S  A  D  H  P  G  L  T  F  S  L      p.2780

          .         .         .         .         .         .       g.194012
 CGCCTCATAAGGAGTGAACCAACCTATAACCAGCCAGTACAGCAGTGGAGCTTTGTCTCT       c.8400
 R  L  I  R  S  E  P  T  Y  N  Q  P  V  Q  Q  W  S  F  V  S         p.2800

           | 20        .         .         .         .         .    g.194170
 GACTTTGCC | GTACGTGACTACTCAGGGACCTATACTGTGAAGCTGGTGCCATGCACTGCC    c.8460
 D  F  A   | V  R  D  Y  S  G  T  Y  T  V  K  L  V  P  C  T  A      p.2820

          .         .         .         .         .         .       g.194230
 CCATCACATCAGGAATACCGCCTGCCAGTCACCTGCAACCCCAGAGAACCTGTCACCTTT       c.8520
 P  S  H  Q  E  Y  R  L  P  V  T  C  N  P  R  E  P  V  T  F         p.2840

          .         .     | 21   .         .         .         .    g.195024
 GACCTTGACATCCGATTCCAACAG | GTCAGTGATCCAGTGGCTGCTGAGTTTAGCTTGAAC    c.8580
 D  L  D  I  R  F  Q  Q   | V  S  D  P  V  A  A  E  F  S  L  N      p.2860

          .         .         .         .         .         .       g.195084
 ACCCAAATGTACCTGCTCTCTAAGAAGAGTCTCTGGTTGTCTGATGGATCCATGGGATTC       c.8640
 T  Q  M  Y  L  L  S  K  K  S  L  W  L  S  D  G  S  M  G  F         p.2880

          .         .         .  | 22      .         .         .    g.196034
 GGGCAAGAGAGTGATGTTGCTTTTGCAGAAG | GTGATATAATTTATGGTCGTGTCATGGTG    c.8700
 G  Q  E  S  D  V  A  F  A  E  G |   D  I  I  Y  G  R  V  M  V      p.2900

          .         .         .         .         .         .       g.196094
 GATCCTGTCCAGAATCTGGGTGACTCCTTTTACTGCAGCATTGAGAAGGTGTTTCTATGC       c.8760
 D  P  V  Q  N  L  G  D  S  F  Y  C  S  I  E  K  V  F  L  C         p.2920

          .         .         .         .         .         .       g.196154
 ACTGGAGCTGATGGCTATGTTCCCAAGTATAGTCCAATGAATGCAGAATATGGCTGCTTA       c.8820
 T  G  A  D  G  Y  V  P  K  Y  S  P  M  N  A  E  Y  G  C  L         p.2940

          .         .         .          | 23        .         .    g.196723
 GCCGACTCTCCTTCACTCTTATATAGATTTAAAATTGTG | GACAAAGCTCAGCCAGAGACA    c.8880
 A  D  S  P  S  L  L  Y  R  F  K  I  V   | D  K  A  Q  P  E  T      p.2960

          .         .         .         .         .         .       g.196783
 CAAGCGACCAGTTTTGGAAATGTCCTATTTAATGCCAAACTAGCAGTGGATGACCCTGAA       c.8940
 Q  A  T  S  F  G  N  V  L  F  N  A  K  L  A  V  D  D  P  E         p.2980

          .         .         .         .         .         .       g.196843
 GCCATTCTCTTAGTGAATCAGCCTGGATCTGATGGATTTAAAGTCGACTCAACACCACTC       c.9000
 A  I  L  L  V  N  Q  P  G  S  D  G  F  K  V  D  S  T  P  L         p.3000

        | 24 .         .         .         .         .         .    g.198209
 TTTCAG | GTCGCTCTAGGCCGAGAATGGTATATACATACGATCTATACAGTGAGATCGAAA    c.9060
 F  Q   | V  A  L  G  R  E  W  Y  I  H  T  I  Y  T  V  R  S  K      p.3020

          .         .         .         .         .         .       g.198269
 GACAATGCCAATCGAGGTATTGGCAAAAGAAGTGTGGAGTACCATTCTCTGGTGAGTCAA       c.9120
 D  N  A  N  R  G  I  G  K  R  S  V  E  Y  H  S  L  V  S  Q         p.3040

          .         .         .         .         .         .       g.198329
 GGAAAGCCCCAATCCACCACCAAGAGCCGGAAGAAGAGAGAGATCAGGAGCACACCCTCA       c.9180
 G  K  P  Q  S  T  T  K  S  R  K  K  R  E  I  R  S  T  P  S         p.3060

          .         .         .         .         .         .       g.198389
 CTGGCATGGGAGATTGGTGCTGAAAACAGTCGAGGAACAAACATCCAGCACATTGCCCTG       c.9240
 L  A  W  E  I  G  A  E  N  S  R  G  T  N  I  Q  H  I  A  L         p.3080

          .         .         .         .         .         .       g.198449
 GACCGCACCAAGAGGCAGATCCCCCATGGGAGAGCACCTCCAGATGGCATCCTCCCCTGG       c.9300
 D  R  T  K  R  Q  I  P  H  G  R  A  P  P  D  G  I  L  P  W         p.3100

          .         .         .         .         .         .       g.198509
 GAGCTCAACAGCCCCAGCTCTGCAGTCAGCCTGGTCACTGTGGTGGGAGGCACCACGGTA       c.9360
 E  L  N  S  P  S  S  A  V  S  L  V  T  V  V  G  G  T  T  V         p.3120

          .         .         .         .         .         .       g.198569
 GGGTTACTCACCATCTGCCTCACTGTCATTGCAGTGCTGATGTGCAGGGGCAAGGAAAGT       c.9420
 G  L  L  T  I  C  L  T  V  I  A  V  L  M  C  R  G  K  E  S         p.3140

          .         .         .         .         .         .       g.198629
 TTCAGGGGGAAGGATGCCCCGAAAGGCTCCAGCAGCAGTGAGCCCATGGTGCCCCCACAG       c.9480
 F  R  G  K  D  A  P  K  G  S  S  S  S  E  P  M  V  P  P  Q         p.3160

          .         .         .                                     g.198659
 AGCCATCACAATGACAGCTCAGAAGTTTGA                                     c.9510
 S  H  H  N  D  S  S  E  V  X                                       p.3169

          .         .         .         .         .         .       g.198719
 tgactgcaggtagaattcaaccttttccgtaagtgcctcggaaaagatcacaatggaacc       c.*60

          .         .         .         .         .         .       g.198779
 ttaaatacttctggtaaaccatagagaatggaggatggctgtgatgaagctgcttagaga       c.*120

          .         .         .         .         .         .       g.198839
 atatgactgtactaatggagtttgatttgaattctccatactcttttttgcatcaaagga       c.*180

          .         .         .         .         .         .       g.198899
 caaattaaggcatctttcctcttgccccaaaggcagcaacaacgtactcatatgtacaca       c.*240

          .         .         .         .         .         .       g.198959
 gagccatgatgtgaggaatgtactcctcattttagacatattctctatgcagtggagata       c.*300

          .         .         .         .         .         .       g.199019
 aatctattaaaaggtgctaacagactctcttacaagtgtaagaggaatctactgttgcta       c.*360

          .         .         .         .         .         .       g.199079
 tgttagtgtgaatgttgaaggtgcaattatcacattgtttattaattgtataacagatta       c.*420

          .         .         .         .         .         .       g.199139
 ttactagaaaggtttttgttgctagtctggaaaactggtgaacacactgtttattatgac       c.*480

          .         .         .         .         .         .       g.199199
 aagttttcaaataggtgaagacagcatagaattatgaccagggtggctcaacccacaaat       c.*540

          .         .         .         .         .         .       g.199259
 caactgatctactacttgggagacagtggaaggaaagatagagggaaggaagttcactca       c.*600

          .         .         .         .         .         .       g.199319
 cttgaatttgaattgcttctcattctcatcagactctccttgttttgtttgcatatttaa       c.*660

          .         .         .         .         .         .       g.199379
 ttttaaattaaaccaaagaatatgttaattctgaaagagatttttaagagatgctgctct       c.*720

          .         .         .         .         .         .       g.199439
 gttttggcatatagtgagtaatggtagagctcttgcatggtaatataccttattggtgct       c.*780

          .         .         .         .         .         .       g.199499
 caacatttgtgggaaattagagggttggtgagattttggtgatgaataaatgccatagag       c.*840

          .         .         .         .         .         .       g.199559
 ttagagtcactacaagacaatgttctctaagaactgagcctagatgtttgcagtattgaa       c.*900

          .         .         .         .         .         .       g.199619
 cccataaatgataataagaaacattgttacagatggtgaagggagaaagtggtatttatt       c.*960

          .         .         .         .         .         .       g.199679
 aatataatgtgtataatcagagtgcctcttatacatactttatagaataaaggaacattt       c.*1020

          .         .         .         .         .         .       g.199739
 tgacagatgaggttatccctcggagtagcgtaatcacacaataacatttagaacttaaat       c.*1080

          .         .         .         .         .         .       g.199799
 tggctacaggacattttattagctttctatccagcatctggtccaaacgatgggactctc       c.*1140

          .         .         .         .         .         .       g.199859
 tgcaactatcattccagaaatggtcttggaggtggccagaatcattgaccatatttttat       c.*1200

          .         .         .         .         .         .       g.199919
 ttggttcaagaagacatcgctctggcatccccagttcagtgaactggtacaatgtggtcc       c.*1260

          .         .         .         .         .         .       g.199979
 ctctcaatatttaaaaatataatttgtaacagtgcttaccattcacctcccaaagccaag       c.*1320

          .         .         .         .         .         .       g.200039
 gaacttgagtgagcttccttggcaagcctcccattgcctttctgcatcaatgtgtttgtt       c.*1380

          .         .         .         .         .         .       g.200099
 accaaatagcagaaatttcgcttagaaggggaaaacttcagctttccaaaagctagtaaa       c.*1440

          .         .         .         .         .         .       g.200159
 catgtttcaaagaaaaataaggtcaggagaaaaagaataatgcctacagattatccttca       c.*1500

          .         .         .         .         .         .       g.200219
 gatgctggctagaatcccctttgacttctagccataagctggccacattggacatcttgg       c.*1560

          .         .         .         .         .         .       g.200279
 tcactgcagaattttaaaaggcaaacttctcagaacagatgtgcacatcttaatttggtg       c.*1620

          .         .         .         .         .         .       g.200339
 tctgtaagtatcaaccatttcttgatcaagataaggaagcaacactgatactgagagaga       c.*1680

          .         .         .         .         .         .       g.200399
 ggtcatatgtccaatagttgcctttcttctcttaggcagctctgcacttcatgttcagtt       c.*1740

          .         .         .         .         .         .       g.200459
 ttttaaaaatagactgtagtatcctttcattggagaatttacaaaaatatcatctacagc       c.*1800

          .         .         .         .         .         .       g.200519
 tcaaaagtcccactaacggcttatatgaacagaaagtactgtgtagcccaggagtttatt       c.*1860

          .         .         .         .         .         .       g.200579
 tagcaagataaatagtggtaatttcttaatcattcccctttcctttgctttaccttctgg       c.*1920

          .         .         .         .         .         .       g.200639
 cagatgcttagctacttctttggctacctcataatttgtatgggaatgaacatgaattag       c.*1980

          .         .         .         .         .         .       g.200699
 ggaacttcaaatagtgcgtagacttttccctacttaccattgggttcaattgatgtagac       c.*2040

          .         .         .         .         .         .       g.200759
 tgttagagcaagtatactcaatcaacttgctgatattttagtagttaacagcttccgagc       c.*2100

          .         .         .         .         .         .       g.200819
 ctatcatgcaatttggagtctgtcaatgaatatagcaatcggtgaagcattactgtacga       c.*2160

          .         .         .         .         .         .       g.200879
 agtctgttttcaggctttgggtcaagctggttttataccaaatttcactctacaatgcat       c.*2220

          .         .         .         .         .         .       g.200939
 attctaatgaagctactttatataaattggagagcttataaaatgcagaacatttctatc       c.*2280

          .         .         .         .         .         .       g.200999
 ctatcctaccaaatatttatccttctctgtcctctattctcttactctcctctctccctt       c.*2340

          .         .         .         .         .         .       g.201059
 tttccttccctttattcccttgaaaaaagagaatctgtgggaaataggcagatatagctt       c.*2400

          .         .         .         .         .         .       g.201119
 tttaaaatataaagtacttgggattttgcattatttttcttaatatctatttactaagta       c.*2460

          .         .         .         .         .         .       g.201179
 tgtaatttaatatacattaattattttttgaaactcttgttagtgggaagaatatggtaa       c.*2520

          .         .         .         .         .         .       g.201239
 attttttgttaaataaaatagacccttatgtttagcattttgtttttagagaactattct       c.*2580

          .         .         .         .         .         .       g.201299
 ggtactatcagaacaaatacataaaataacttcccatagagaacaggatatagcaataat       c.*2640

          .         .         .         .         .         .       g.201359
 agctccttagatactcagtggcttctgactccaatcaaggtcttgttgatattatatagt       c.*2700

          .         .         .         .         .         .       g.201419
 aaaaataaaaccaaaaataaatattattcaagtggctcttctaagcatgtgaatcatgaa       c.*2760

          .         .         .         .         .         .       g.201479
 gcactgaaatatgtattttaatgatgatcttatttattcccatttttgcccttagttaac       c.*2820

          .         .         .         .         .         .       g.201539
 atttactggtgctcacctaggattggctattctgagggattgcatagaaaccaagctcca       c.*2880

          .         .         .         .         .         .       g.201599
 cttgctgtccttgggaaggttataactgaatgcagctctttatttggactaaagtgtcag       c.*2940

          .         .         .         .         .         .       g.201659
 gatatgcattagattctctcctgaaccaaaaacacaacagtcattatctgtgaaccataa       c.*3000

          .         .         .         .         .         .       g.201719
 tttaaaaatctttctagaataacaacagcagactccactcttgtttgtctaaaagagccc       c.*3060

          .         .         .         .         .         .       g.201779
 tactgggtatggatcattctgatgacagatttatacaaaatgattcaaaccagtaactta       c.*3120

          .         .         .         .         .         .       g.201839
 gtaaaattgaccttcgcaaaacctcactgggggagtgccttgtagagctgtgggtgggac       c.*3180

          .         .         .         .         .         .       g.201899
 tgcacattcttttcctcttagtaaaagataggcccactttattccaagaataacacttag       c.*3240

          .         .         .         .         .         .       g.201959
 cacataaactcttcttccagctcgttagcagcattagcaccttctgaattccaccctctc       c.*3300

          .         .         .         .         .         .       g.202019
 agaagaatccacagtgtttgaacaatttgcataaaggtcagctagcatcctgctgccaag       c.*3360

          .         .         .         .         .         .       g.202079
 ccactgcatagcatttgtgataagaaggaccaactctaggctcaatatgaagggatttag       c.*3420

          .         .         .         .         .         .       g.202139
 ttctgtaagcagcaaaaaagcttctttatcaagtcatcttacctctaattcttttccagt       c.*3480

          .         .         .         .         .         .       g.202199
 gtgccaactccaaagtcaacattaaaaatgtaaatggacctgtgtaaatatcacagagag       c.*3540

          .         .         .         .         .         .       g.202259
 cttttccttatacatctcaatgctgagagttaaaatattcccaggttaaaatttttttaa       c.*3600

          .         .         .         .         .         .       g.202319
 agtaccaataatagagctaaatacaatgacatttgcttttaaaaggtggatattttattt       c.*3660

          .         .         .         .         .         .       g.202379
 ctgctttttgaaaatacttatttagtattgacttggaagccaatttggtcctttaataag       c.*3720

          .         .         .         .         .         .       g.202439
 taaagaaaataatatgtttaaaaatgtaaatgttttacaaatttgaaactttcataattg       c.*3780

          .         .         .         .         .         .       g.202499
 tattaatcagaaaacaagcacattgccattctttgaaactcatgtttctagacatgacag       c.*3840

          .         .         .         .         .         .       g.202559
 cagtaataaaaggatgaaaacaagtgtcttcactaagcgtatggccaataaatgggaccc       c.*3900

          .         .         .         .         .         .       g.202619
 aaacgttcaatctgttcagtttaccaaggttcagaaatacgtaatttagcaggaaactat       c.*3960

          .         .         .         .         .         .       g.202679
 aaataccagtgctatcacagccacacatacacacacacagacataaaataaccaaacatc       c.*4020

          .         .         .         .         .         .       g.202739
 tcatttctaggaaagagataacactaaaggcatcataggtttaactgaaatacgttatat       c.*4080

          .         .         .         .         .         .       g.202799
 gaagttttacaaaaaggtcaacagaaagctcatttgtgaaaacatactctcatgggagct       c.*4140

          .         .         .         .         .         .       g.202859
 tctttaacattagttcagaggttaatatatttcctggaggtgttttcctagaattgattg       c.*4200

          .         .         .         .         .         .       g.202919
 cactattgcatggtaataacatttaattgttaaggaaacattatatataggttcaaatta       c.*4260

          .         .         .         .         .         .       g.202979
 tcccttaatgttgatttctccccttttccatggattttgatactaagaaacaaaatgctt       c.*4320

          .         .         .         .         .         .       g.203039
 tgagattttggtaactattttgattttgataaaacatgttaaaatagaaggacatgatat       c.*4380

          .         .         .         .         .         .       g.203099
 ttttctatagtttccatcaggaagagtacatcagaaacttctccataaggaaagaaaact       c.*4440

          .         .         .         .         .         .       g.203159
 gactctctcttgaactagtgttgacaaaatacactaatgtctttcttaattttattttat       c.*4500

          .         .         .         .         .         .       g.203219
 taggagaaaaatcagaatattaaatttgcaaacttttgaacagcagtaatagctccttag       c.*4560

          .         .         .         .         .         .       g.203279
 acactcagtatctttcttccctatctttcaagcacatttaatttctttcccctggtattt       c.*4620

          .         .         .         .         .         .       g.203339
 gtttgctttgtgttttttcaatattttgtttgctaaagaacaataacaacaacaaagctg       c.*4680

          .         .         .         .         .         .       g.203399
 gtccagccctgacacctacttttgctttttttctttctttcttttaatttgttgaactat       c.*4740

          .         .         .         .         .         .       g.203459
 aggtttctttctgagatgtatttttcattcttccaataatgctctctttttcatttcaaa       c.*4800

          .         .         .         .         .         .       g.203519
 accattaccactttcaatatgtaattaacatcctcattcatcagaaagctggtaagtcca       c.*4860

          .         .         .         .         .         .       g.203579
 cacagcatttgtgcagtatcccttctgtgtaaaatgttaaggctttcagatgaaagaaaa       c.*4920

          .         .         .         .         .         .       g.203639
 aagaacttcctgcaaaagatcaaaagcatcatactaaataaaatgatgacaatatgtgcc       c.*4980

          .         .         .         .         .         .       g.203699
 ttgatttttctctcaatggaggttcaacattgacatttaagatgtaaaaaaaattacttt       c.*5040

          .         .         .         .         .         .       g.203759
 gatggtttaattaagaataataagtcaaatatcacatgtatgtagttcttttggatgacc       c.*5100

          .         .         .         .         .         .       g.203819
 gaataccttaaaatgaactaaataactgaaataaagtgttaaaatgttaacagcgttgaa       c.*5160

          .         .         .         .         .         .       g.203879
 gtttttaaaattataattatcaaatgcacaatgttcttttactatgccaaatgttgccta       c.*5220

          .         .         .         .         .         .       g.203939
 cactgattacatgattgtcacagtttaagtgaatttctactatggatctttattttcccc       c.*5280

          .         .         .         .         .         .       g.203999
 aatgtttggatcatcctctcagataagaattgtcagtattgcacctcaagaaagaagaaa       c.*5340

          .         .         .         .         .         .       g.204059
 aaataagaatgtaaatttttaaaagctagcattaaaagtaaagagcagtacaataaaaat       c.*5400

          .         .         .         .         .         .       g.204119
 cacttaaaatagagaaaggcaactactgagtaagaagaaaagataatttctgtaaaagct       c.*5460

          .         .         .         .         .         .       g.204179
 aaatttatgcacattacaaaaagtagtcaagtcagtcttccattgtgacttcaggaattc       c.*5520

          .         .         .         .         .         .       g.204239
 aaatgcaagttgttggcaaaatatatatatacacacacacacacatacacacacatatat       c.*5580

          .         .         .         .         .         .       g.204299
 gtacatacatatatatatagagagagagagatagattttttttttttgagacagagtttc       c.*5640

          .         .         .         .         .         .       g.204359
 gctcttgttgcccaggctggagtgcaatggaatgatcttggctcaccgcaacctccgcct       c.*5700

          .         .         .         .         .         .       g.204419
 ccagggttcaagtgattctcctgcctcaacctcctgagtagctggaattacaggtgccca       c.*5760

          .         .         .         .         .         .       g.204479
 ctaccatgcctggctagtttttgtatttttagtagagacagggtttctccatgttggtca       c.*5820

          .         .         .         .         .         .       g.204539
 ggctgatctcgaactcccaacctcagatgatcctcccgcctccacctcccaaagtactgg       c.*5880

          .         .         .         .         .         .       g.204599
 aattacaatggcgtgagccaccacaagatatttttaaagcccatttgtctataaaagaaa       c.*5940

          .         .         .         .         .         .       g.204659
 actcttggacaaggagctttgtgttttataattgtattacgtgcctgcttccttaccaag       c.*6000

          .         .         .         .         .         .       g.204719
 tgccctccataacactaagtaaatttatatttatctagcctctgagtgacatatctgtgt       c.*6060

          .         .         .         .         .         .       g.204779
 gtaatggaattatttgcagaatttaatagccttttttattttcgcatgagaatttttcaa       c.*6120

          .         .         .         .         .         .       g.204839
 aaactatcagggtctagttttatcatacatttactaagttactacatattggtggatatt       c.*6180

          .         .         .         .         .         .       g.204899
 gacgtttattcctgggaatctaattttgcaaacaatttggagccattcagtcataaattc       c.*6240

          .         .         .         .         .         .       g.204959
 atgtcaacaataagtcttgctgccgcttgtgtttcataactacgcttgctttccttcaaa       c.*6300

          .         .         .         .                           g.205003
 atataccaagtgtgtaatataaataaagcccatatcaatataaa                       c.*6344

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The FRAS1 related extracellular matrix protein 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 35
©2004-2018 Leiden University Medical Center