gap junction protein, beta 6, 30kDa (GJB6) - coding DNA reference sequence

(used for mutation description)

(last modified August 8, 2013)


This file was created to facilitate the description of sequence variants in the GJB6 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008323.1, covering GJB6 transcript NM_006783.4.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.4738
                                                cttttccctcaag       c.-541

 .         .         .         .         .         .                g.4798
 tagactttatgccatacagctattttcttgccccagttctagcagaatctaaccagtgtt       c.-481

 .         .         .         .         .         .                g.4858
 ctagaagaaaatgtcctgcccccatgcagtctccttagaattgcagggtgctgctcagaa       c.-421

 .         .         .         .         .         .                g.4918
 ctgctcctgtggagagctttgtctgttgtttggatccagcagcgtctttgggggtgttgc       c.-361

 .         .         .         .         .         .                g.4978
 ttgaagcttgccaaggaggagaggggggttctgaagagagaacaccagggctctagcctg       c.-301

 .         .         .         .         .         .                g.5038
 tcacataactgggggtgtggagagcgcctcattgccactgcagtgactaaagctgggaag       c.-241

 .         .         .         .         .         .     | 02       g.6214
 acgctggtcagttcacctgccccactggttgttttttaaacaaattctgatacag | gcgac    c.-181

 .         .         .         .         .         .                g.6274
 atcctcactgaccgagcaaagattgacattcgtatcatcactgtgcaccattggcttcta       c.-121

 .         .         .         .         .         .                g.6334
 ggcactccagtggggtaggagaaggaggtctgaaaccctcgcagagggatcttgccctca       c.-61

 .         .         .         .         .     | 03   .             g.12478
 ttctttgggtctgaaacactggcagtcgttggaaacaggactcag | ggataaaccagcgca    c.-1

          .         .         .         .         .         .       g.12538
 ATGGATTGGGGGACGCTGCACACTTTCATCGGGGGTGTCAACAAACACTCCACCAGCATC       c.60
  M  D  W  G  T  L  H  T  F  I  G  G  V  N  K  H  S  T  S  I        p.20

          .         .         .         .         .         .       g.12598
 GGGAAGGTGTGGATCACAGTCATCTTTATTTTCCGAGTCATGATCCTCGTGGTGGCTGCC       c.120
  G  K  V  W  I  T  V  I  F  I  F  R  V  M  I  L  V  V  A  A        p.40

          .         .         .         .         .         .       g.12658
 CAGGAAGTGTGGGGTGACGAGCAAGAGGACTTCGTCTGCAACACACTGCAACCGGGATGC       c.180
  Q  E  V  W  G  D  E  Q  E  D  F  V  C  N  T  L  Q  P  G  C        p.60

          .         .         .         .         .         .       g.12718
 AAAAATGTGTGCTATGACCACTTTTTCCCGGTGTCCCACATCCGGCTGTGGGCCCTCCAG       c.240
  K  N  V  C  Y  D  H  F  F  P  V  S  H  I  R  L  W  A  L  Q        p.80

          .         .         .         .         .         .       g.12778
 CTGATCTTCGTCTCCACCCCAGCGCTGCTGGTGGCCATGCATGTGGCCTACTACAGGCAC       c.300
  L  I  F  V  S  T  P  A  L  L  V  A  M  H  V  A  Y  Y  R  H        p.100

          .         .         .         .         .         .       g.12838
 GAAACCACTCGCAAGTTCAGGCGAGGAGAGAAGAGGAATGATTTCAAAGACATAGAGGAC       c.360
  E  T  T  R  K  F  R  R  G  E  K  R  N  D  F  K  D  I  E  D        p.120

          .         .         .         .         .         .       g.12898
 ATTAAAAAGCAGAAGGTTCGGATAGAGGGGTCGCTGTGGTGGACGTACACCAGCAGCATC       c.420
  I  K  K  Q  K  V  R  I  E  G  S  L  W  W  T  Y  T  S  S  I        p.140

          .         .         .         .         .         .       g.12958
 TTTTTCCGAATCATCTTTGAAGCAGCCTTTATGTATGTGTTTTACTTCCTTTACAATGGG       c.480
  F  F  R  I  I  F  E  A  A  F  M  Y  V  F  Y  F  L  Y  N  G        p.160

          .         .         .         .         .         .       g.13018
 TACCACCTGCCCTGGGTGTTGAAATGTGGGATTGACCCCTGCCCCAACCTTGTTGACTGC       c.540
  Y  H  L  P  W  V  L  K  C  G  I  D  P  C  P  N  L  V  D  C        p.180

          .         .         .         .         .         .       g.13078
 TTTATTTCTAGGCCAACAGAGAAGACCGTGTTTACCATTTTTATGATTTCTGCGTCTGTG       c.600
  F  I  S  R  P  T  E  K  T  V  F  T  I  F  M  I  S  A  S  V        p.200

          .         .         .         .         .         .       g.13138
 ATTTGCATGCTGCTTAACGTGGCAGAGTTGTGCTACCTGCTGCTGAAAGTGTGTTTTAGG       c.660
  I  C  M  L  L  N  V  A  E  L  C  Y  L  L  L  K  V  C  F  R        p.220

          .         .         .         .         .         .       g.13198
 AGATCAAAGAGAGCACAGACGCAAAAAAATCACCCCAATCATGCCCTAAAGGAGAGTAAG       c.720
  R  S  K  R  A  Q  T  Q  K  N  H  P  N  H  A  L  K  E  S  K        p.240

          .         .         .         .         .         .       g.13258
 CAGAATGAAATGAATGAGCTGATTTCAGATAGTGGTCAAAATGCAATCACAGGTTTCCCA       c.780
  Q  N  E  M  N  E  L  I  S  D  S  G  Q  N  A  I  T  G  F  P        p.260

                                                                    g.13264
 AGCTAA                                                             c.786
  S  X                                                              p.261

          .         .         .         .         .         .       g.13324
 acatttcaaggtaaaatgtagctgcgtcataaggagacttctgtcttctccagaaggcaa       c.*60

          .         .         .         .         .         .       g.13384
 taccaacctgaaagttccttctgtagcctgaagagtttgtaaatgactttcataataaat       c.*120

          .         .         .         .         .         .       g.13444
 agacacttgagttaactttttgtaggatacttgctccattcatacacaacgtaatcaaat       c.*180

          .         .         .         .         .         .       g.13504
 atgtggtccatctctgaaaacaagagactgcttgacaaaggagcattgcagtcactttga       c.*240

          .         .         .         .         .         .       g.13564
 caggttccttttaagtggactctctgacaaagtgggtactttctgaaaatttatataact       c.*300

          .         .         .         .         .         .       g.13624
 gttgttgataaggaacatttatccaggaattgatacgtttattaggaaaagatattttta       c.*360

          .         .         .         .         .         .       g.13684
 taggcttggatgtttttagttctgactttgaatttatataaagtatttttataatgactg       c.*420

          .         .         .         .         .         .       g.13744
 gtcttccttacctggaaaaacatgcgatgttagttttagaattacaccacaagtatctaa       c.*480

          .         .         .         .         .         .       g.13804
 atttggaacttacaaagggtctatcttgtaaatattgttttgcattgtctgttggcaaat       c.*540

          .         .         .         .         .         .       g.13864
 ttgtgaactgtcatgatacgcttaaggtggaaagtgttcattgcacaatatatttttact       c.*600

          .         .         .         .         .         .       g.13924
 gctttctgaatgtagacggaacagtgtggaagcagaaggcttttttaactcatccgtttg       c.*660

          .         .         .         .         .         .       g.13984
 ccaatcattgcaaacaactgaaatgtggatgtgattgcctcaataaagctcgtccccatt       c.*720

          .                                                         g.13997
 gcttaagccttca                                                      c.*733

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Gap junction protein, beta 6, 30kDa protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 35
©2004-2013 Leiden University Medical Center