hemoglobin subunit alpha 1 (HBA1) - coding DNA reference sequence

(used for mutation description)

(last modified February 4, 2018)


This file was created to facilitate the description of sequence variants in the HBA1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from VERSION NG_000006.1, covering HBA1 transcript NM_000558.4.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5037
                        actcttctggtccccacagactcagagagaacccacc       c.-1

          .         .         .         .         .         .       g.5097
 ATGGTGCTGTCTCCTGCCGACAAGACCAACGTCAAGGCCGCCTGGGGTAAGGTCGGCGCG       c.60
  M  V  L  S  P  A  D  K  T  N  V  K  A  A  W  G  K  V  G  A        p.20

          .         .         .      | 02  .         .         .    g.5274
 CACGCTGGCGAGTATGGTGCGGAGGCCCTGGAGAG | GATGTTCCTGTCCTTCCCCACCACC    c.120
  H  A  G  E  Y  G  A  E  A  L  E  R |   M  F  L  S  F  P  T  T     p.40

          .         .         .         .         .         .       g.5334
 AAGACCTACTTCCCGCACTTCGACCTGAGCCACGGCTCTGCCCAGGTTAAGGGCCACGGC       c.180
  K  T  Y  F  P  H  F  D  L  S  H  G  S  A  Q  V  K  G  H  G        p.60

          .         .         .         .         .         .       g.5394
 AAGAAGGTGGCCGACGCGCTGACCAACGCCGTGGCGCACGTGGACGACATGCCCAACGCG       c.240
  K  K  V  A  D  A  L  T  N  A  V  A  H  V  D  D  M  P  N  A        p.80

          .         .         .         .         .         .       g.5454
 CTGTCCGCCCTGAGCGACCTGCACGCGCACAAGCTTCGGGTGGACCCGGTCAACTTCAAG       c.300
  L  S  A  L  S  D  L  H  A  H  K  L  R  V  D  P  V  N  F  K        p.100

  | 03       .         .         .         .         .         .    g.5663
  | CTCCTAAGCCACTGCCTGCTGGTGACCCTGGCCGCCCACCTCCCCGCCGAGTTCACCCCT    c.360
  |  L  L  S  H  C  L  L  V  T  L  A  A  H  L  P  A  E  F  T  P     p.120

          .         .         .         .         .         .       g.5723
 GCGGTGCACGCCTCCCTGGACAAGTTCCTGGCTTCTGTGAGCACCGTGCTGACCTCCAAA       c.420
  A  V  H  A  S  L  D  K  F  L  A  S  V  S  T  V  L  T  S  K        p.140

                                                                    g.5732
 TACCGTTAA                                                          c.429
  Y  R  X                                                           p.142

          .         .         .         .         .         .       g.5792
 gctggagcctcggtggccatgcttcttgccccttgggcctccccccagcccctcctcccc       c.*60

          .         .         .         .         .                 g.5843
 ttcctgcacccgtacccccgtggtctttgaataaagtctgagtgggcggca                c.*111

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Hemoglobin subunit alpha 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 35
©2004-2018 Leiden University Medical Center