hemoglobin subunit gamma 2 (HBG2) - coding DNA reference sequence

(used for mutation description)

(last modified February 4, 2018)

This file was created to facilitate the description of sequence variants in the HBG2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from VERSION NG_000007.3, covering HBG2 transcript NM_000184.2.

Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.5023
                                      ataaaaggaagcacccttcagca       c.-61

 .         .         .         .         .         .                g.5083
 gttccacacactcgcttctggaacgtctgaggttatcaataagctcctagtccagacgcc       c.-1

          .         .         .         .         .         .       g.5143
  M  G  H  F  T  E  E  D  K  A  T  I  T  S  L  W  G  K  V  N        p.20

          .         .         .   | 02     .         .         .    g.5325
  V  E  D  A  G  G  E  T  L  G  R |   L  L  V  V  Y  P  W  T  Q     p.40

          .         .         .         .         .         .       g.5385
  R  F  F  D  S  F  G  N  L  S  S  A  S  A  I  M  G  N  P  K        p.60

          .         .         .         .         .         .       g.5445
  V  K  A  H  G  K  K  V  L  T  S  L  G  D  A  I  K  H  L  D        p.80

          .         .         .         .         .         .       g.5505
  D  L  K  G  T  F  A  Q  L  S  E  L  H  C  D  K  L  H  V  D        p.100

          .      | 03  .         .         .         .         .    g.6451
  P  E  N  F  K  |  L  L  G  N  V  L  V  T  V  L  A  I  H  F  G     p.120

          .         .         .         .         .         .       g.6511
  K  E  F  T  P  E  V  Q  A  S  W  Q  K  M  V  T  G  V  A  S        p.140

          .         .                                               g.6535
 GCCCTGTCCTCCAGATACCACTGA                                           c.444
  A  L  S  S  R  Y  H  X                                             p.147

          .         .         .         .         .         .       g.6595
 gctcactgcccatgatgcagagctttcaaggataggctttattctgcaagcaatcaaata       c.*60

          .                                                         g.6610
 ataaatctattctgc                                                    c.*75

 (downstream sequence)
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Hemoglobin subunit gamma 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 35
©2004-2018 Leiden University Medical Center