Kruppel like factor 1 (KLF1) - coding DNA reference sequence

(used for mutation description)

(last modified February 4, 2018)


This file was created to facilitate the description of sequence variants in the KLF1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from VERSION NG_013087.1, covering KLF1 transcript NM_006563.4.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                                    g.4982
                                                          tca       c.-61

 .         .         .         .         .         .                g.5042
 gagttcacgaggcagccgaggaagaggaggcttgaggcccagggtgggcaccagccagcc       c.-1

          .         .         .         .         .         .       g.5102
 ATGGCCACAGCCGAGACCGCCTTGCCCTCCATCAGCACACTGACCGCCCTGGGCCCCTTC       c.60
  M  A  T  A  E  T  A  L  P  S  I  S  T  L  T  A  L  G  P  F        p.20

          .         .        | 02.         .         .         .    g.6073
 CCGGACACACAGGATGACTTCCTCAAG | TGGTGGCGCTCCGAAGAGGCGCAGGACATGGGC    c.120
  P  D  T  Q  D  D  F  L  K  |  W  W  R  S  E  E  A  Q  D  M  G     p.40

          .         .         .         .         .         .       g.6133
 CCGGGTCCTCCTGACCCCACGGAGCCGCCCCTCCACGTGAAGTCTGAGGACCAGCCCGGG       c.180
  P  G  P  P  D  P  T  E  P  P  L  H  V  K  S  E  D  Q  P  G        p.60

          .         .         .         .         .         .       g.6193
 GAGGAAGAGGACGATGAGAGGGGCGCGGACGCCACCTGGGACCTGGATCTCCTCCTCACC       c.240
  E  E  E  D  D  E  R  G  A  D  A  T  W  D  L  D  L  L  L  T        p.80

          .         .         .         .         .         .       g.6253
 AACTTCTCGGGCCCGGAGCCCGGTGGCGCGCCCCAGACCTGCGCTCTGGCGCCCAGCGAG       c.300
  N  F  S  G  P  E  P  G  G  A  P  Q  T  C  A  L  A  P  S  E        p.100

          .         .         .         .         .         .       g.6313
 GCCTCCGGGGCGCAATATCCGCCGCCGCCCGAGACTCTGGGCGCATATGCTGGCGGCCCG       c.360
  A  S  G  A  Q  Y  P  P  P  P  E  T  L  G  A  Y  A  G  G  P        p.120

          .         .         .         .         .         .       g.6373
 GGGCTGGTGGCTGGGCTTTTGGGTTCGGAGGATCACTCGGGTTGGGTGCGCCCTGCCCTG       c.420
  G  L  V  A  G  L  L  G  S  E  D  H  S  G  W  V  R  P  A  L        p.140

          .         .         .         .         .         .       g.6433
 CGAGCCCGGGCTCCCGACGCCTTCGTGGGCCCAGCCCTGGCTCCAGCCCCGGCCCCCGAG       c.480
  R  A  R  A  P  D  A  F  V  G  P  A  L  A  P  A  P  A  P  E        p.160

          .         .         .         .         .         .       g.6493
 CCCAAGGCGCTGGCGCTGCAACCGGTGTACCCGGGGCCCGGCGCCGGCTCCTCGGGTGGC       c.540
  P  K  A  L  A  L  Q  P  V  Y  P  G  P  G  A  G  S  S  G  G        p.180

          .         .         .         .         .         .       g.6553
 TACTTCCCGCGGACCGGGCTTTCAGTGCCTGCGGCGTCGGGCGCCCCCTACGGGCTACTG       c.600
  Y  F  P  R  T  G  L  S  V  P  A  A  S  G  A  P  Y  G  L  L        p.200

          .         .         .         .         .         .       g.6613
 TCCGGGTACCCCGCGATGTACCCGGCGCCTCAGTACCAAGGGCACTTCCAGCTCTTCCGC       c.660
  S  G  Y  P  A  M  Y  P  A  P  Q  Y  Q  G  H  F  Q  L  F  R        p.220

          .         .         .         .         .         .       g.6673
 GGGCTCCAGGGACCCGCGCCCGGTCCCGCCACGTCCCCCTCCTTCCTGAGTTGTTTGGGA       c.720
  G  L  Q  G  P  A  P  G  P  A  T  S  P  S  F  L  S  C  L  G        p.240

          .         .         .         .         .         .       g.6733
 CCCGGGACGGTGGGCACTGGACTCGGGGGGACTGCAGAGGATCCAGGTGTGATAGCCGAG       c.780
  P  G  T  V  G  T  G  L  G  G  T  A  E  D  P  G  V  I  A  E        p.260

          .         .         .         .         .         .       g.6793
 ACCGCGCCATCCAAGCGAGGCCGACGTTCGTGGGCGCGCAAGAGGCAGGCAGCGCACACG       c.840
  T  A  P  S  K  R  G  R  R  S  W  A  R  K  R  Q  A  A  H  T        p.280

          .         .         .         .         .         .       g.6853
 TGCGCGCACCCGGGTTGCGGCAAGAGCTACACCAAGAGCTCCCACCTGAAGGCGCATCTG       c.900
  C  A  H  P  G  C  G  K  S  Y  T  K  S  S  H  L  K  A  H  L        p.300

          .    | 03    .         .         .         .         .    g.7169
 CGCACGCACACAG | GGGAGAAGCCATACGCCTGCACGTGGGAAGGCTGCGGCTGGAGATTC    c.960
  R  T  H  T   | G  E  K  P  Y  A  C  T  W  E  G  C  G  W  R  F     p.320

          .         .         .         .         .         .       g.7229
 GCGCGCTCGGACGAGCTGACCCGCCACTACCGGAAACACACGGGGCAGCGCCCCTTCCGC       c.1020
  A  R  S  D  E  L  T  R  H  Y  R  K  H  T  G  Q  R  P  F  R        p.340

          .         .         .         .         .         .       g.7289
 TGCCAGCTCTGCCCACGTGCTTTTTCGCGCTCTGACCACCTGGCCTTGCACATGAAGCGC       c.1080
  C  Q  L  C  P  R  A  F  S  R  S  D  H  L  A  L  H  M  K  R        p.360

                                                                    g.7298
 CACCTTTGA                                                          c.1089
  H  L  X                                                           p.362

          .         .         .         .         .         .       g.7358
 gccctgccctggcacttggactctcctagtgactggggatgggacaagaagcctgtttgg       c.*60

          .         .         .         .         .         .       g.7418
 tggtctcttcacacggacgcgcgtgacacaatgctgggtggttttcccacgaatggaccc       c.*120

          .         .         .         .         .         .       g.7478
 tctcctggactcgcgttcccaaagatccacccaaatatcaaacacggacccatagacagc       c.*180

          .         .         .         .         .         .       g.7538
 cctgggggagcctcttacggaaaatccgacaagccttcagccacagggagccacacagag       c.*240

          .         .         .         .         .         .       g.7598
 atgtccaaactgtcgtgcaaacccagtgagacagaccgccaaataaacggactcagtgga       c.*300

          .         .         .         .         .         .       g.7658
 cactcagaccagctcccagatggccctggacagcaggagagggtgtgggatgaggcttcc       c.*360

          .         .         .         .         .         .       g.7718
 cagagaccctgggtctagaaagcggctcctgaaggtcccttattgtggctgatattaact       c.*420

          .         .         .         .                           g.7761
 gtcaatggttatgggtcctataaaaatgcccctcccagataaa                        c.*463

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Kruppel like factor 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 35
©2004-2018 Leiden University Medical Center